Khóa luận Nghiên cứu tình trạng methyl hoá chỉ thị phân tử SEPT9 ở bệnh nhân ung thư đại trực tràng Việt Nam

pdf 84 trang thiennha21 13/04/2022 1160
Bạn đang xem 20 trang mẫu của tài liệu "Khóa luận Nghiên cứu tình trạng methyl hoá chỉ thị phân tử SEPT9 ở bệnh nhân ung thư đại trực tràng Việt Nam", để tải tài liệu gốc về máy bạn click vào nút DOWNLOAD ở trên

Tài liệu đính kèm:

  • pdfkhoa_luan_nghien_cuu_tinh_trang_methyl_hoa_chi_thi_phan_tu_s.pdf

Nội dung text: Khóa luận Nghiên cứu tình trạng methyl hoá chỉ thị phân tử SEPT9 ở bệnh nhân ung thư đại trực tràng Việt Nam

  1. ĐẠI HỌC THÁI NGUYÊN TRƯỜNG ĐẠI HỌC NÔNG LÂM TRẦN HOÀI NAM Tên đề tài: NGHIÊN CỨU TÌNH TRẠNG METHYL HOÁ CHỈ THỊ PHÂN TỬ SEPTIN 9 Ở BỆNH NHÂN UNG THƯ ĐẠI TRỰC TRÀNG VIỆT NAM Hệ đào tạo : Chính quy Ngành : Công nghệ sinh học Khoa : CNSH - CNTP Khóa học : 2016-2020 Thái Nguyên - năm 2020
  2. ĐẠI HỌC THÁI NGUYÊN TRƯỜNG ĐẠI HỌC NÔNG LÂM TRẦN HOÀI NAM Tên đề tài: NGHIÊN CỨU TÌNH TRẠNG METHYL HOÁ CHỈ THỊ PHÂN TỬ SEPTIN 9 Ở BỆNH NHÂN UNG THƯ ĐẠI TRỰC TRÀNG VIỆT NAM Hệ đào tạo : Chính quy Ngành : Công nghệ sinh học Lớp : 48-CNSH Khoa : CNSH-CNTP Khóa học : 2016-2020 Người hướng dẫn : 1. PGS.TS. Dương Văn Cường 2. Th.S.Vũ Hoài Nam Thái Nguyên, năm 2020
  3. i LỜI CẢM ƠN Trong quá trình học tập và nghiên cứu để hoàn thành được khoá luận tốt nghiệp này cùng với sự nỗ lực của cá nhân, em đã nhận được sự hướng dẫn, giúp đỡ, chỉ bảo và động viên của thầy cô, bạn bè và gia đình. Em xin tỏ lòng biết ơn sâu sắc tới thầy giáo PGS.TS. Dương Văn Cường, TS. Hoàng Phú Hiệp, Th.S Vũ Hoài Nam, người đã trực tiếp hướng dẫn và giúp đỡ em trong suốt thời gian thực hiện đề tài cũng như trong quá trình hoàn chỉnh luận văn tốt nghiệp. Em xin chân thành cảm ơn các thầy cô trong khoa CNSH - CNTP đã dạy dỗ và giúp đỡ em trong suốt thời gian vừa qua. Em xin chân thành cảm ơn đến tới các cán bộ, anh chị làm việc tại Viện Khoa học Sự sống - Đại học Thái Nguyên đã giúp đỡ tạo điều kiện để em được học tập và nghiên cứu. Cuối cùng em xin gửi lời cảm ơn tới gia đình, người thân, bạn bè đã luôn động viên, chia sẻ giúp đỡ em vượt qua mọi khó khăn trong quá trình học tập, nghiên cứu và hoàn thiện bản thân. Em xin chân thành cảm ơn ! Thái Nguyên, ngày tháng năm 2020 Sinh viên Trần Hoài Nam
  4. ii DANH MỤC BẢNG Bảng 3.1. Bảng liệt kê các hoá chất cần sử dụng trong quá trình thí nghiệm 20 Bảng 3.2. Bảng liệt kê các dụng cụ cần thiết trong quá trình thí nghiệm 21 Bảng 3.3: Bố trí thí nghiệm tách chiết DNA với bốn phương pháp 23 Bảng 3.4. Quy trình tách chiết DNA từ mẫu mô cố định formaldehyde bằng phương pháp A 23 Bảng 3.5. Quy trình tách chiết DNA từ mẫu mô người cố định formaldehyde bằng phương pháp B 24 Bảng 3.6. Quy trình tách chiết DNA từ mẫu mô người cố định formaldehyde bằng phương pháp C 25 Bảng 3.7. Quy trình tách chiết DNA từ mẫu mô người cố định formaldehyde bằng bộ Tissue Genomic DNA Extraction Mini Kit [Theo hướng dẫn nhà sản xuất FavorPrep] 26 Bảng 3.8 : Bố trí thí nghiệm tách chiết DNA từ mẫu mô cố định formaldehyde của bệnh nhân ung thư đại trực tràng 28 Bảng 3.9: Bố trí thí nghiệm 29 Bảng 3.11: Thành phần phản ứng PCR 31 Bảng 3.12: Bố trí thí nghiệm chạy PCR khuếch đại gene FAT1 32 Bảng 4.1: Thống kê về độ tuổi phát hiện bệnh ung thư đại trực tràng 34 Bảng 4.2 : Thống kê giới tính của bệnh nhân ung thư đại trực tràng 34 Bảng 4.3: Thống kê về giai đoạn phát hiện bệnh 35 Bảng 4.4: Thống kê tỷ lệ phát hiện bệnh khi đã bị di căn của nghiên cứu này và tỷ lệ tương tự của Hoa Kỳ (được công bố bởi Hiệp hội ung thư Hoa Kỳ) 35 Bảng 4.5 : Kết quả đo nồng độ DNA 38 Bảng 4.6 : Kết quả đo tỷ số OD260/280 39 Bảng 4.7 : Kết quả đo tỷ số OD260/230 40 Bảng 4.8: Kết quả mức độ nhiễm tạp chất và phenol trong mẫu DNA của bốn phương pháp 41 Bảng 4.9: Thống kê 4 phương pháp 42 Bảng 4.10 : Kết quả đo nồng độ DNA 44
  5. iii Bảng 4.11: Kết quả đo tỷ số OD260/280 45 Bảng 4.12: Kết quả đo tỷ số OD260/230 45 Bảng 4.13 : Trình tự promoter trên gene SEPT9 47
  6. iv DANH MỤC HÌNH Hình 2.1 : Hình ảnh vị trí đại tràng và trực tràng ở người 13 Hình 2.2: Quá trình xác định mức độ methyl hoá của DNA 17 Hình 3.1: Chu trình nhiệt của phản ứng PCR khuếch đại gene FAT1 30 Hình 3.2: Chu trình nhiệt chạy PCR khuếch đại gene FAT1 31 Hình 3.3 : Chu trình nhiệt phản ứng PCR khuếch đại gene FAT1 32 Hình 4.1. DNA được tách chiết từ mẫu mô cố định formaldehyde được tách chiết từ bộ KIT chuẩn của công ty Clini Sciences 36 Hình 4.2: Kết quả điện di sản phẩm DNA được tách từ 4 phương pháp A, B, C và bộ KIT 37 Hình 4.3: Kết quả điện di sản phẩm DNA được tách chiết từ mẫu mô 14173 - U phương pháp B 43 Hình 4.4: Vị trí và kích thước của gene SEPT9 46 Hình 4.5: Thiết kế mồi khuếch đại promoter của gene SEPT9 47 Hình 4.6: Kết quả chạy khuếch đại gene FAT1 48 Hình 4.7: Kết quả PCR khuếch đại gene FAT1 49 Hình 4.8: Kết quả PCR gen FAT1 49
  7. v MỤC LỤC LỜI CẢM ƠN i DANH MỤC BẢNG ii DANH MỤC HÌNH iv MỤC LỤC v Phần 1. MỞ ĐẦU 8 1.1. Đặt vấn đề 8 1.1 Mục tiêu của đề tài 9 1.1.1 Mục tiêu tổng quát 9 1.1.2 Mục tiêu cụ thể 9 1.2 Ý nghĩa khoa học và thực tiễn 9 1.2.1 Ý nghĩa khoa học của đề tài 9 1.2.2 Ý nghĩa thực tiễn của đề tài 9 Phần 2. TỔNG QUAN TÀI LIỆU 10 2.1. Ung thư 10 2.1.1. Khái niệm ung thư 10 2.1.1. Cơ chế hình thành bệnh ung thư 10 2.2. Ung thư đại trực tràng 12 2.2.1. Khái niệm 12 2.2.2. Các yếu tố nguy cơ ung thư đại trực tràng 13 2.2.3. Tình hình ung thư đại trực tràng Error! Bookmark not defined. 2.3. Mối liên hệ giữa Methyl hoá DNA và ung thư đại trực tràng 14 2.3.1. Methyl hoá DNA 14 2.4. Nguyên lý kỹ thuật xác định mức độ methyl hóa DNA dựa trên biến đổi bisulfite 16 2.5. Giới thiệu về kỹ thuật xác định methyl hóa DNA hiệu năng cao Illumina Infinium 450K 17 2.6. Nghiên cứu trong nước và quốc tế về methyl hóa của gene SEPT9 trên bệnh nhân ung thư đại trực tràng 17
  8. vi Phần 3. ĐỐI TƯỢNG, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 20 3.1. Đối tượng nghiên cứu và phạm vi nghiên cứu 20 3.1.1. Đối tượng nghiên cứu 20 3.1.2. Phạm vi nghiêm cứu 20 3.1.3. Vật liệu và dụng cụ thí nghiệm 20 3.2. Địa điểm và thời gian nghiên cứu 21 3.3. Nội dung nghiên cứu 21 3.4. Phương pháp nghiên cứu 22 3.4.1. Phương pháp thu thập và đánh giá số liệu ung thư CRC ở bệnh viện K TW 22 3.4.2. Phương pháp tách chiết DNA từ mẫu mô cố định formaldehyde 22 3.4.3. Thiết kế mồi PCR đặc hiệu methyl hoá bằng phương pháp thiết kế Insilicon. 28 3.4.4. Quá trình chuyển hoá bisulfite cho mẫu DNA. 29 Phần 4. KẾT QUẢ VÀ THẢO LUẬN 34 4.1. Kết quả thu thập và phân tích số liệu lâm sàng trên 151 mẫu bệnh phẩm của bệnh nhân ung thư đại trực tràng được thu thập ngẫu nhiên tại bệnh viện K TW 34 4.1.1. Kết quả phân tích về độ tuổi phát hiện ung thư 34 4.1.2. Kết quả phân tích về giới tính 34 4.1.3. Kết quả phân tích về giai đoạn phát hiện bệnh 35 4.1.4. Khảo sát về tỷ lệ mức độ cả bệnh khi phát hiện ra bị ung thư đại trực tràng tại bệnh viện K TW 35 4.2. Kết quả tách chiết DNA 36 4.2.1. Kết quả lựa chọn phương pháp phù hợp tách chiết DNA từ mẫu mô cố định formaldehyde 37 4.2.3. Kết quả tách chiết DNA từ mẫu mô cố định formaldehyde bằng B đã tối ưu và phương pháp sử dụng Tissue Genomic DNA Extraction Mini Kit 43 4.3. Kết quả thiết kế mồi PCR đặc hiệu methyl hoá. 46 4.3.1. Thu thập thông tin gene SEPT9 từ cơ sở dữ liệu database 46 4.3.2. Xác định trình tự promoter trên gene SEPT9 47 4.3.3. Thiết kế mồi PCR đặc hiệu methyl hóa 47
  9. vii 4.4. Kết quả chuyển hoá bisulfite đối với DNA được tách chiết từ mẫu mô cố định formaldehyde của bệnh nhân ung thư đại trực tràng 48 4.4.1. Kết quả chất lượng DNA chuẩn bị cho quá trình biến đổi bisufite 48 4.4.2. Kết quả chuyển đổi bisufite 50 Phần 5. KẾT LUẬN VÀ KIẾN NGHỊ 51 5.1. Kết luận 51 5.2. Kiến nghị 51 TÀI LIỆU THAM KHẢO 52
  10. Phần 1 MỞ ĐẦU 1.1. Đặt vấn đề Ung thư đại trực tràng (Colorectal cancer - CRC) là một trong những loại ung thư phổ biến ở người. Trên thế giới, CRC xếp thứ 3 về tỷ lệ người mắc bệnh sau ung thư phổi và ung thư tuyến tiền liệt ở nam giới, đứng thứ 2 sau ung thư vú ở nữ giới. Ở Việt Nam, tỷ lệ người mắc CRC đứng thứ năm sau ung thư gan, phổi, dạ dày và vú. Tỉ lệ mắc CRC chiếm 8,7% tổng số bệnh nhân ung thư.[1] Hằng năm, có hơn 945.000 người mắc bệnh ung thư đại trực tràng trên thế giới và có khoảng 492.000 bệnh nhân tử vong, trong số đó bệnh nhân châu Á chiếm 51,3% tổng số ca mắc trên toàn thế giới. Theo dự đoán của các chuyên gia tại Hội thảo Ung thư Việt Pháp lần thứ 3 diễn ra tại Hà nội, tới năm 2025 ung thư đại trực tràng sẽ vươn lên hàng thứ hai ở nam giới và thứ tư ở nữ giới. Việc sàng lọc thường xuyên có thể giúp phòng ngừa và phát hiện sớm ung thư đại trực tràng. Theo thống kê của Hiệp hội phòng ngừa Hoa Kỳ công bố mỗi năm có khoảng 60% bệnh nhân bị ung thư đại trực tràng tử vong, nếu được sàng lọc định kỳ thường xuyên tỷ lệ bệnh nhân mắc bệnh có thể sống thêm 5 năm tăng từ 46% đến 73%. Vì thế việc được sàng lọc thường xuyên sẽ giúp kéo dài thời gian sống khi phát hiện kịp thời.[5] Trong số những cơ chế gây nên ung thư nói chung và ung thư đại trực tràng nói riêng, cơ chế methyl hoá DNA có vai trò quan trọng. Những biến đổi về di truyền ngoại gen (epigenetic) có liên quan tới quá trình phát sinh ung thư. Nghiên cứu tình trạng methyl hoá DNA có tiềm năng ứng dụng cao trong sàng lọc, chẩn đoán lâm sàng và theo dõi điều trị ung thư.3 Gen SEPT9 ở người là một trong những chỉ thị sinh học hàng đầu để giúp phát hiện và chẩn đoán lâm sàng một số bệnh ung thư trong đó có ung thư đại trực tràng.[5] Trên thế giới đã có những nghiên cứu về tình trạng methyl hoá ở gene SEPT9 của bệnh nhân ung thư đại trực tràng, tuy nhiên những nghiên cứu trên đa số đều nghiên cứu trên đối tượng người da trắng và người da đen. Mặt khác, methyl hoá DNA có một phần nguyên nhân phụ thuộc vào sắc tộc và môi trường sống.
  11. Hiện nay, theo tìm hiểu của chúng tôi chưa có một nghiên cứu nào nghiên cứu về tình trạng methyl hoá DNA trên gene SEPT9 của bệnh nhân ung thư đại trực tràng Việt Nam. Xuất phát từ những luận điểm trên, chúng tôi thực hiện đề tài: “ Nghiên cứu tình trạng methyl hoá chỉ thị phân tử SEPT9 ở bệnh nhân ung thư đại trực tràng Việt Nam”. 1.1 Mục tiêu của đề tài 1.1.1 Mục tiêu tổng quát Thiết lập một số kỹ thuật làm nền tảng cho nghiên cứu khảo sát mức độ methyl hóa chỉ thị SEPT9 trên khối u của bệnh nhân CRC Việt Nam. 1.1.2 Mục tiêu cụ thể - Thu thập và phân tích một số dữ liệu lâm sàng trên tập hợp 151 mẫu bệnh phẩm của bệnh nhân ung thư đại trực tràng được thu thập ngẫu nhiên tại Việt Nam. - Tìm và tối ưu được phương pháp thích hợp để tách chiết DNA từ mẫu mô cố định formaldehyde. Tách chiết khoảng 50 mẫu DNA và đánh giá được chất lượng. - Phân tích in silico cấu trúc gene SEPT9 và thiết kế được bộ mồi PCR đặc hiệu methyl hoá. - Thực hiện được kỹ thuật PCR đặc hiệu methyl hóa. 1.2 . Ý nghĩa khoa học và thực tiễn 1.2.1 Ý nghĩa khoa học của đề tài Nghiên cứu tình trạng methyl hoá chỉ thị phân tử SEPT9 ở bệnh nhân ung thư đại trực tràng Việt Nam tạo tiền đề cho các nghiên cứu về methyl hoá gen chỉ thị phân tử khác của các bệnh ung thư. 1.2.2 Ý nghĩa thực tiễn của đề tài Nghiên cứu tình trạng methyl hoá chỉ thị phân tử SEPT9 ở bệnh nhân ung thư đại trực tràng Việt Nam mở ra những hướng nghiên cứu liên quan đến ứng dụng trong sàng lọc, chẩn đoán và hỗ trợ điều trị bệnh ung thư đại trực tràng.
  12. Phần 2 TỔNG QUAN TÀI LIỆU 2.1. Ung thư 2.1.1. Khái niệm ung thư Ung thư là sự tăng trưởng bất thường của các tế bào. Ung thư có thể phát sinh từ bất cứ cơ quan nào trên cơ thể hoặc có thể là các tế bào nhỏ đã mất khả năng ngừng phát triển, dẫn đến cơ thể bị mất khả năng kiểm soát.[1] 2.1.2. Cơ chế hình thành bệnh ung thư Có nhiều tác nhân gây ung thư, tất cả đều làm biến đổi hoặc đột biến các tế bào trong cơ thể dẫn đến sự tăng sinh mất kiểm soát của các tế bào này. Cơ thể được cấu tạo từ rất nhiều loại tế bào, các tế bào đều có sự phát triển và phân chia một cách có kiểm soát, các tế bào sẽ chết theo chu trình được lập sẵn (chương trình Apoptosis) và thay vào là các tế bào mới mạnh khoẻ để duy trì các chức năng của cơ thể. Các tác nhân gây đột biến như hoá chất độc hại, tia phóng xạ, các virus ung thư làm cho các tế bào bình thường bị đột biến gene hoặc NST, nên tế bào mất khả năng kiểm soát sự phân chia và liên kết tế bào. Vật liệu di truyền (DNA) của một tế bào bị thay đổi hoặc hư hỏng làm tăng sinh vô tổ chức các tế bào lỗi (tế bào ung thư). Các tế bào không chết đi theo chương trình Apoptosis như các tế bào bình thường mà tăng sinh và nhân lên một cách mất kiểm soát. Các tế bào này có thể sẽ tạo thành một khối lớn gọi là khối u. Không phải khối u nào cũng là ung thư, các khối u không lây lan ra các phần khác của cơ thể là khối u lành tính, không phải ung thư. Các khối u lành tính được cắt bỏ và đa số sẽ tái phát. Các khối u có khả năng di căn sang các phần khác gọi là u ác tính hay còn được gọi là ung thư.[1] Cơ chế gây bệnh ung thư do đột biến gene làm mất kểm soát chu kỳ tế bào. Cơ thể có hai nhóm gene kiểm soát chu kỳ của tế bào: Nhóm gene quy định yếu tố sinh trưởng và nhóm gene gây ức chế khối u. Ở các tế bào bình thường hai nhóm gene này hoạt động hài hoà với nhau. Tuy nhiên khi có đột biến, cơ chế này bị phá vỡ và tế bào nhân lên không kiểm soát.[1] Các giai đoạn phát triển của ung thư [1] :
  13. - Giai đoạn khởi phát: Bắt đầu từ khi tế bào gốc tiếp xúc với các tác nhân gây đột biến và trở thành tế bào khởi phát. - Giai đoạn tăng trưởng, thúc đẩy, chuyển biến: tế bào ung thư còn ở mức độ nhỏ, cư trú ở một mô trên cơ thể - Gian đoạn lan tràn: Giai đoạn này có thể kéo dài vài tháng hoặc vài năm. Các khối u tăng sinh mạnh mẽ. - Giai đoạn tiến triển, xâm lấn, di căn: Giai đoạn này là sự tăng kích thước của các khối u. Đây là giai đoạn khối u phát triển nhanh và xâm lấn các mô tổ chức khác. Có rất nhiều nguyên nhân gây nên bệnh ung thư, như: Yếu tố di truyền, tiếp xúc với các chất hoá học, các tia phóng xạ, hút thuốc lá thường xuyên, chế độ ăn uống không lành mạnh, lười vận động Hầu hết các ung thư lần đầu được chẩn đoán dựa vào các triệu chứng xuất hiện hoặc nhờ vào quá trình tầm soát. Qua đó không thể chẩn đoán xác định được mà phải nhờ vào sinh thiết. Một số trường hợp ung thư khác được chẩn đoán tình cờ nhờ khi đang khám hoặc điều trị bệnh khác. Triệu chứng của hầu hết các bệnh nhân ung thư đều không rõ ràng. Khi xuất hiện triệu chúng rõ ràng thường là khi bệnh đã tiến triển trầm trọng. Thông thường ung thư có thời gian ủ bệnh khá dài, khoảng 10 năm hoặc hơn nữa tuỳ vào từng thể loại ung thư. Do đó cách phòng và điều trị ung thư hiệu quả nhất được khuyến cáo là nên đi khám sức khỏe định kì 6 tháng một lần. Do ung thư là tập hợp của nhiều dạng bệnh khác nhau nên triệu chứng của ung thư rất đa dạng và khác nhau tuỳ vào từng thể loại ung thư. Nói chung, triệu chứng của ung thư được chia làm ba nhóm chính : Triệu chứng tại chỗ: Các khối u bất thường hay phù nề, chảy máu, đau hoặc loét. Chèn ép vào các mô xung quanh có thể gây ra các triệu chứng như vàng da. Triệu chứng di căn : Hạch bạch huyết lớn lên, ho ra máu, gan to, đau xương, gãy xương ở những xương bị tổn thương và các triệu chứng thần kinh. Đau có thể gặp ở ung thư giai đoạn tiến triển, nhưng thông thường đó không phải là triệu chứng đầu tiên. Triệu chứng toàn thân : Sụt cân, chán ăn, suy mòn, tiết nhiều mồ hôi, thiếu máu và các hội chứng cận u đặc hiệu, đó là tình trạng đặc biệt được gây ra bởi ung thư đang hoạt động, chẳng hạn như huyết khối hay thay đổi nội tiết tố.
  14. 2.2. Ung thư đại trực tràng 2.2.1. Khái niệm Ung thư đại trực tràng (CRC) hay còn gọi là ung thư ruột, ung thư ruột kết hoặc ung thư trực là một trong những ung thư hàng đầu trên thế giới cũng như ở Việt Nam. Ung thư đại trực tràng được đánh giá là dạng ung thư đứng thứ ba ở Mỹ trên cả nam và nữ .Ở Việt Nam, ung thư đại trực tràng là ung thư phổ biến thứ năm sau ung thư gan, phổi, dạ dày, vú.[5] Ung thư đại trực tràng thường xuất hiện phổ biến ở những người trên 50 tuổi.Tuy nhiên, những năm gần đây ung thư đại trực tràng có xu hướng xuất hiện ngày càng nhiều ở những người có độ tuổi trẻ hơn. Theo số liệu thống kê của WHO 2018, Việt Nam mỗi năm ghi nhận 15.000 ca mắc mới, tỷ lệ 13,4/100.000 dân và khoảng 7.000 ca tử vong. Trên thới giới, mỗi năm có thêm 8 triệu ca mắc mới, trong đó có 860.000 ca tử vong và con số này đang không ngừng tăng lên. Trong đó, các quốc gia châu Á chiếm 51,3% tổng ca mắc trên toàn cầu.[18] Đại tràng và trực tràng là phần cuối của hệ thống ống tiêu hóa, thường gọi là ruột già, đóng vai trò quan trọng trong việc xử lý các thức ăn không tiêu hóa được (chất xơ, ), một số vi khuẩn ở ruột già có thể sản xuất các vitamin cho cơ thể, hấp thụ thức ăn và tạo nên phân để thải ra ngoài. Đại trực tràng ở người trường thành thường có kích thước khoảng 1,5 - 1,8 m; phần ruột lớn hình chữ N gồm manh tràng, đại tràng lên, đại tàng ngang, đại tràng xuống, đại tràng sigma và trực tràng. Trực tràng là đoạn cuối của ống tiêu hóa đi từ chỗ nối đại tràng sigma cho đến đường lược, dài khoảng 15 cm. Trực tràng chia làm 3 phần: trực tràng trên cách rìa hậu môn 12- 18 cm, trực tràng giữa cách rìa hậu môn 6-12 cm và trực tràng rìa hậu môn dưới 6 cm.[2]
  15. Hình 2.1 : Hình ảnh vị trí đại tràng và trực tràng ở người [2] CRC là loại ung thư hay gặp đứng thứ 2 trong các loại ung thư đường tiêu hóa và là một trong những nguyên nhân hàng đầu gây tử vong nếu không được chẩn đoán và điều trị sớm. CRC thường gặp là ung thư tuyến biểu mô, gây nên bởi sự phát triển bất thường của các tế bào có khả năng xâm lấn hoặc lan rộng ra các bộ phận khác của cơ thể và bắt gặp ở bất kì vị trí nào của đại trực tràng. Theo nghiên cứu của Kahamoui cho thấy 43% ung thư xảy ra ở vị trí của trực tràng, 25% là ở đại tràng sigma, đại tràng lên chỉ 18%, đại tràng ngang 9% và đại tràng xuống là 5%. 2.2.2. Các yếu tố nguy cơ ung thư đại trực tràng Có rất nhiều yếu tố nguy cơ gây nên bệnh CRC. Dựa vào thống kê có hai nhóm yếu tố chính gây bệnh[1]: Yếu tố di truyền: - Hoạt hóa các gene tiền ung thư, bất hoạt các gene ức chế khối u, sai hỏng trong sửa chữa ADN và di truyền. - Trong yếu tố di truyền, khi có thành viên trong gia đình được chẩn đoán - mắc bệnh ung thư đại trực tràng thì nguy cơ mắc bệnh các thành viên khác cao gấp nhiều lần so với mức trung bình, phụ thuộc vào số thành viên mắc bệnh và độ tuổi mắc bệnh. Ngoài ra, có mối liên quan giữa các hội chứng bệnh và CRC: hội chứng Lynch, hội chứng Turcot, hội chứng Peutz-Jeghers sẽ dẫn đến bệnh CRC. Yếu tố không di truyền:
  16. - Viêm loét dạ dày lâu ngày, các tác nhân vật lý hóa học, chế độ ăn uống sinh hoạt hay do lão hóa. - Thói quen ăn uống: Chế độ ăn uống ít chất xơ, giàu đạm hay thói quen sử dụng bia rượu, hút thuốc lá thường xuyên có thể gây ra những biến đổi trong tế bào mô đại tràng dẫn đến viêm loét trực tràng và dẫn tới CRC. 2.3 . Mối liên hệ giữa Methyl hoá DNA và ung thư đại trực tràng 2.3.1. Methyl hoá DNA 2.3.1.1. Khái niệm ’ Methyl hoá DNA là hiện tượng gắn thêm gốc methyl (-CH3) vào vị trí 5 C của nucleotide. Ở một số trường hợp, Adenine bị methyl hoá phổ biến đóng vai trò quan trọng trong cơ chế bảo vệ đối với vi khuẩn. Trong khi đó ở động vật có vú, methyl hoá xảy ra ở cytosine đứng trước guanine trong phức CpG tạo thành 5 methyl Cytosine (5mC). Trong hệ gen người, đảo CpG là vùng nhiều phức CpG có kích thước từ 0,5 – 5,0 kb và thường tìm thấy ở các vùng promoter của các gen. Khi các đảo CpG bị methyl hoá, các gen không được phiên mã. Methyl hoá xảy ra ở các đảo CpG thuộc vùng promoter của gen chiếm ưu thế so với các vị trí khác, bởi vậy khi đánh giá tình trạng methyl hoá DNA thường xem xét tại vùng chứa đảo CpG. Ngoài ra, methyl hoá DNA có vai trò nhất định đối với các tế bào ở trạng thái bình thường như in dấu gen, duy trì trạng thái dị nhiễm sắc, duy trì trạng thái bất hoạt một gen nhiễm sắc thể X ở động vật có vú. Ở tế bào bình thường, các Cytosine trong phức CpG không bị methyl hoá trong quá trình phát triển và biệt hoá mô, tuy nhiên các đảo CpG thuộc vùng promoter của gen có thể bị methyl hoá dẫn đến tình trạng ức chế quá trình phiên mã của gen. Methyl hoá DNA được hình thành trong quá trình biệt hoá tế bào, làm tế bào mất một phần hoặc mất hoàn toàn khả năng phân chia tế bào. Methyl hoá DNA có tính đặc hiệu với các mô trong cơ thể và vai trò của hiện tượng này ở các tế bào khác nhau là không giống nhau. Ở tế bào bình thường, promoter mang các đảo CpG không bị methyl hoá có chức năng duy trì cấu trúc nhiễm sắc thực, đây là cấu trúc cho phép gen được biểu hiện. Tuy nhiên, trong quá trình phát sinh ung thư, CpG vùng promoter nhiều gen bị methyl hoá gây ức chế biểu hiện gen do thay đổi cấu trúc nhiễm sắc thể thực thành cấu trúc dị nhiễm sắc.[8]
  17. 2.3.1.3. Bất thường methyl hoá DNA trong ung thư đại trực tràng Ở người, methyl hóa một số vị trí CpG nhất định trong vùng promoter của gene ức chế khối u có thể dẫn đến gene không hoạt động và mất chức năng ức chế khối u dẫn đến sự bắt đầu phát triển của ung thư. Sự thay đổi bất thường của methyl hóa này đã được tìm thấy phổ biến trong ung thư đại trực tràng. Dựa trên các nghiên cứu đã công bố, methyl hóa bất thường xảy ra phổ biến ở giai đoạn đầu của bệnh và nếu kiểm tra tình trạng gene sẽ có thể phát hiện sớm tình trạng di căn ác tính của ung thư. Việc phát hiện methyl hóa trong các chất dịch của cơ thể như máu, nước tiểu, phân và mô đang là xu hướng nghiêm cứu của các nhà khoa học trên thế giới.[9] Gene O6-methyl Quanin-DNA methyl transferase (MGMT) mã hóa cho enzyme MGMT có chức năng sửa chữa DNA theo cơ chế loại bỏ các chất gây đột biến và gây độc từ O6-guanine trong DNA. Quá trình methyl hóa MGMT có liên quan đến việc thiếu biểu hiện mRNA đồng thời mất hàm lượng protein và hoạt động của enzyme. Sự thay đổi di truyền trong O6-methyl Quanin-DNA methyl transferase (MGMT), làm suy giảm khả năng của protein MGMT để loại bỏ nhóm alkyl hóa khỏi guanine O6 và do đó làm tăng tỷ lệ và nguy cơ gây ung thư.[6] Nhiều cơ chế điều hòa biểu hiện DNA mà không làm thay đổi trình tự nucleotide. Sự điều hòa biểu hiện thông qua quá trình methyl hóa các vùng kích thích gene là phổ biến ở ung thư đại trực tràng và cũng quan trọng như đột biến DNA trong việc làm bất hoạt các gene ức chế khối u. Quá trình methyl hóa liên quan đến sự liên kết cộng hóa trị của một nhóm methyl với vị trí 5 của cytosine và diễn ra trong các đảo CpG lặp đi lặp lại hoặc các đoạn DNA nhiều CpG trong vùng promoter. CpG gắn các cytosine (C) theo sau là guanosine (G), với một liên kết phosphodiester (p).[6] Trong các tế bào bình thường, đảo CpG thường được duy trì ở trạng thái không được methyl hóa. Trong trường hợp không bị methyl hóa, gene được thể hiện bình thường. Với sự hiện diện của quá trình methyl hóa, gen không được điều hòa phiên mã (tức là im lặng). Sự im lặng của gene ức chế khối u có thể là kết quả của quá trình methyl hóa liên quan đến cả hai bản sao của gene ức chế khối u, hoặc sự kết hợp mất một alen thông qua việc xóa hoặc đột biến kết hợp với im lặng của alen khác thông qua quá trình methyl hóa.[6]
  18. 2.4. Nguyên lý kỹ thuật xác định mức độ methyl hóa DNA dựa trên biến đổi bisulfite Xác định mức độ biến đổi trong quá trình methyl hoá DNA ngày càng trở nên quan trọng trong nghiên cứu y sinh và đặc biệt là trong nghiên cứu ung thư, vì các dấu ấn sinh học có vai trò quan trọng trong việc chẩn đoán ung thư. Một số phương pháp được sử dụng để phân tích mức độ methyl hoá DNA, từ các kỹ thuật xác định các CpG, đến giải trinh tự gen hoặc lai với các microarrays. Nhiều kỹ thuật phân tích dựa trên các nguyên lý chung để xử lý DNA bằng bisulfite. Natri bisulfite chuyển đổi các cytosine không bị methyl hoá sang uracil, sau đó từ uracil chuyển hoá thành thymine sau khi đã qua quá trình khuếch đại phản ứng polymerase. Ngược lại các cytosine bị methyl hoá sau khi qua quá trình bisulfite sẽ không bị ảnh hưởng. Vì lý do độ nhạy, bước khuếch đại sẽ được xử lý sau quá trình bisulfite. Do phép đo các cytosine bị methyl hoá được đếm sau khi đã khuếch đại mà không phải DNA ban đầu, nên độ chính xác của PCR ảnh hưởng lớn tới độ chính xác của phân tích.[8] Sự khuếch đại DNA của kỹ thuật PCR sau khi đã được xử lý qua quá trình bisulfite thường làm đa dạng có chọn lọc các các alen không bị methyl hoá, hiện tượng đó được gọi là sai lệch PCR, do có thể đánh giá không chính xác mức độ methyl hoá. Tuy nhiên mức độ sai lệch PCR rất khó dự đoán. Một số phương pháp đã được đưa ra để giải quyết các điều kiện thí nghiệm cho sự khuếch đại không sai lệch. Một trong những phương pháp đấy là sử dụng các cặp mồi PCR được thiết kế đặc biệt trong đó có chứa các dinucleotide CpG (thường là 1 hoặc 2). Sử dụng cặp mồi đặc hiệu các tác dụng tạo điều kiện cho cặp mồi gắn được vào các alen bị methyl hoá và do đó có thể tránh được việc khuếch đại các alen không cần thiết. Để tránh sai lệch PCR, người ta thường tối ưu hoá các điều kiệu PCR như: nhiệt độ, thời gian, Tuy nhiên phương pháp này tốn nhiều thời gian và công sức, vì vậy đã có một phương pháp khác được đưa ra. Thay vì điều chỉnh các điều kiện của phản ứng PCR người ta sẽ thay đổi một cách thích hợp các kết quả thu được sau khi khuếch đại. Để đạt được mục đích này, cần một quá trình phân tích xác định được mức độ methyl hoá của các mẫu DNA song song với việc chạy PCR mẫu DNA. So sánh và đưa ra độ lệch chuẩn chính xác cho kết quả .[8]
  19. Hình 2.2: Quá trình xác định mức độ methyl hoá của DNA bằng phương pháp chuyển hoá bisulfite.[8] 2.5. Giới thiệu về kỹ thuật xác định methyl hóa DNA hiệu năng cao Illumina Infinium 450K Khi phân tích sự thay đổi methyl hóa DNA trong đảo CpG, phương pháp điều chỉnh bisulfile natri để phân biệt giữa DNA bị methyl hóa và không methyl hóa kết hợp với sử dụng các enzyme hạn chế nhạy cảm với methyl (ví dụ R. Hpa II) và specific (ví dụ R. Mcr BCI) hoặc sử dụng thuốc thử đặc hiệu có ái lực cao cho methyl hóa (ví dụ kháng thể kháng 5meC hoặc polypeptide gắn methyl tái tổ hợp). Tuy nhiên, các kỹ thuật này đòi hỏi trình độ chuyên môn cao, chi phí lớn và mất thời gian. Trong khi đó methyl hoá DNA người Illumina Infinium 450K (Illumina Infinium Human Methylation 450K BeadChip) được phát triển để đánh giá định lượng methyl hóa trên bộ gene người hiệu quả trong xác nhận chức năng sinh học và chức năng methyl hóa của ung thư đại trực tràng. Áp dụng kĩ thuật này để xác định các vị trí methyl hóa mới có thể tương quan với sự hiện diện của CpG hoặc dẫn đến việc làm “im lặng gene”.[19] 2.6. Nghiên cứu trong nước và quốc tế về methyl hóa của gene SEPT9 trên bệnh nhân ung thư đại trực tràng a. Trên thế giới Trên thế giới, đã có nhiều nghiên cứu về ứng dụng methyl hóa của gene SET9 trên ung thư đại trực tràng.
  20. Năm 2017, Lele Song, Jia Jia ,Xiumei Peng, Wenhua Xiao và Yuemin Li công bố công trình nghiên cứu “Hiệu suất của xét nghiệm methyl hóa gen SEPT9 và so sánh với các xét nghiệm sàng lọc CRC khác” chỉ ra rằng xét nghiệm phát hiện ctDNA để sàng lọc ung thư đại trực tràng và phát hiện sớm cho thấy có độ nhạy và độ đặc hiệu cao. Tại Trung quốc, các nhà khoa học đã chỉ ra rằng bệnh nhân ung thư đại trực tràng có nồng độ methyl hoá trên gene SEPT9 dương tính và độ methyl hoá trên gene SEPT9 định lượng có liên quan chặt chẽ với các thông số bệnh lý lâm sàng. Xét nghiệm methyl hoá trên gene SEPT9 là một công cụ chẩn đoán chính xác và nhanh chóng cho bệnh nhân ung CRC Trung Quốc, nó có thể cho chúng ta biết thêm thông tin có giá trị về giai đoạn khối u hiện tại và có khả năng theo dõi tái phát CRC [ Xue Yang et al., 2019]. Cho đến nay, đã có 25 nghiên cứu độc lập được thực hiện để điều tra hiệu suất của xét nghiệm methyl hóa gen SEPT9 trong phát hiện CRC, trong đó hầu hết các nghiên cứu là nghiên cứu trường hợp hoặc đối chứng, trong khi chỉ có một nghiên cứu sàng lọc đa trung tâm ngẫu nhiên và hai nghiên cứu sàng lọc cơ hội được thực hiện để điều tra hiệu suất của nó trong dân số có nguy cơ trung bình và dân số có nguy cơ cao. Gần đây nhất, ngày 18/4/2020, hai nhà nghiên cứu Rohit Harihara và Mark Jenkins đã phân tích dữ liệu từ 19 nghiên cứu đã chỉ ra rằng: xét nghiệm mSEPT9 có khả năng sàng lọc CRC dân số với khả năng phát hiện khoảng hai phần ba trường hợp CRC và loại trừ 92% trường hợp không mắc.[10] b. Trong nước Nghiên cứu về methyl hóa trong ung thư ở Việt Nam còn rất hạn chế. Theo tìm hiểu của chúng tôi, chỉ có một vài công bố liên quan đến cơ thế methyl hóa chỉ thị các gene trên bệnh nhân ung thư ở người. Vũ Tràng Lan và cộng sự năm 2018 nghiên cứu methyl hóa BRCA1, RASSF1A và GSTP1 ở phụ nữ Việt Nam bị ung thư vú đã chỉ ra rằng sự methyl hóa trong các mô khối u của BRCA1, RASSF1A và lần lượt là 58,23%, 74,68% và 59,49% và ở các mô lân cận tương ứng là 51,90%, 63,29% và 35,44% .[11]
  21. - Nghiên cứu sự liên quan giữa methyl hoá gene DcR1 và ung thư cổ thử cung của phụ nữ Việt Nam đã chỉ ra rằng quá trình hypermethylation của gen DcR 1 là một đặc điểm quan trọng của các bệnh nhân nhiễm HPV có nguy cơ ung thư cổ tử cung.[12] - Võ Thị Thường Lan và cộng sự chỉ ra rằng quá trình methyl hóa GSTP1 và RASSF1A bằng có thể được sử dụng như một dấu ấn sinh học để chẩn đoán ung thư tuyến tiền liệt khi nghiên cứu methyl hóa Promoter của GSTP1 và RASSF1A trong ung thư tuyến tiền liệt và tăng sản lành tính ở nam giới Việt Nam.[13] Tuy nhiên chưa có nghiên cứu nào công bố về nghiên cứu mức độ methyl hoá chỉ thị gene SEPT9 của bệnh nhân ung thư đại trực tràng Việt Nam.
  22. Phần 3 ĐỐI TƯỢNG, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1. Đối tượng nghiên cứu và phạm vi nghiên cứu 3.1.1. Đối tượng nghiên cứu Mẫu khối u và tế bào lành liền kề khối u của bệnh nhân ung thư đại trực tràng Việt Nam được bảo quản trong dung dịch formaldehyde được cung cấp bởi bệnh viện K TW. 3.1.2. Phạm vi nghiêm cứu Nghiên cứu tình trạng methyl hoá của gen SEPT9 ở bệnh nhân ung thư đại trực tràng tại Việt Nam 3.1.3. Vật liệu và dụng cụ thí nghiệm 3.1.3.1. Vật liệu a. Vật liệu Mẫu khối u và tế bào lành liền kề khối u của bệnh nhân ung thư đại trực tràng Việt Nam được cố định formaldehyde được cung cấp bởi bệnh viện K TW b. Hoá chất Bảng 3.1. Bảng liệt kê các hoá chất cần sử dụng trong quá trình thí nghiệm STT Tên hoá chất sử dụng 1 Cồn 2 Nước cất, nước khử ion 3 GTE (100mM glycine, 10mM Tris – HCL pH=8, 1mM EDTA) 4 Lysis buffer (Tris Hcl 1M, EDTA 05M, SDS 10%) 5 Proteinase K (Thermo Scientific) 6 Rnase (Thermo Scientific) 7 Loading dye (Thermo Scientific) 8 Gene Ruler (Thermo Scientific) 9 Ethidium Bromide 10 PBS (Na2HPO4 . 2H20, NaH2PO4. H2O, Nacl) 11 TAE 1X (Tris base, Acid acetic, EDTA) 12 Agarose 13 TE (100mM Tris/1mM EDTA) 14 CIAA (Chloroform, Isoamylakihol) 15 Alkali (0,1M NaOH, SDS 1%, pH= 12) 16 10X DreamTaq Buffer (Thermo Scientific) 17 DreamTaq DNA Polymerase (Thermo Scientific) 18 10 mM dNTP Mix (Thermo Scientific) 19 Dung dịch 25:24:1 (Phenol, Chloroform, Isoamylakihol) 20 Cặp mồi FLI1 CpG U (PHUSA Biochem) 21 Cặp mồi USP44 CpG U (PHUSA Biochem) 22 Cặp mồi USP44 CpG M (PHUSA Biochem) 23 Cặp mồi FAT1 (PHUSA Biochem)
  23. 3.1.3.2. Dụng cụ thí nghiệm Bảng 3.2. Bảng liệt kê các dụng cụ cần thiết trong quá trình thí nghiệm STT Dụng cụ và thiết bị Tên hãng 1 Pipette, dao, kéo,phanh, giấy parafilm 2 Ống Eppendorf (2ml; 1,5ml; 200µl; 100µl), ống Fancol 15 ml 3 Bộ Tissue Genomic DNA Extraction Mini Kit FavorPrep 4 Bộ EZ DNA Methylation - Gold Zymo Research 5 Ống đong, cốc đong, bình định mức, bình chịu nhiệt, 6 Máy chuẩn pH, máy khấy từ, lò vi sóng, tủ lạnh 7 Tủ cấy, tủ hút khí 8 Máy IK Votex, máy lắc, máy spindowwn Genius 3 9 Máy ly tâm lạnh Mikro 220R Hettich 10 Bể ổn nhiệt Grant 11 Bể điện di Scie - Plas 12 Máy soi gel Wealtec corp UVtronsilluminator 13 Máy phân tích hình ảnh Gellogic 1500 14 Máy PCR GextrogeneTE Thermocycler 15 Máy PCR Applied Biosytems 16 Máy đo độ quang phổ Naodrop One Thermo scientific 3.2. Địa điểm và thời gian nghiên cứu Địa điểm: Bộ môn Sinh học phân tử và Công nghệ gen, Viện Khoa học sự sống, Đại học Thái Nguyên. Thời gian: Đề tài được thực hiện từ tháng 12/2019 đến tháng 7/ 2014. 3.3. Nội dung nghiên cứu Nội dung 1: Phân tích một số dữ liệu lâm sàng trên 151 mẫu bệnh phẩm được thu thập ngẫu nhiên tại bệnh viện K TW.
  24. Nội dung 2: Phân tích kết quả DNA được tách từ mẫu mô cố định formaldehyde - Tìm ra quy trình tối ưu tách chiết DNA từ mẫu mô cố định formaldehyde của bệnh nhân ung thư đại trực tràng. - Phân tích kết quả số liệu DNA tách chiết từ mẫu mô cố định formaldehyde. Nội dung 3: Thiết kế mồi PCR đặc hiệu methyl hoá - Truy xuất trình tự gene. - Tìm kiếm vị trí promoter và vị trí CpG cần quan tâm. - Thiết kế mồi đặc hiệu methyl hoá. Nội dung 4: Chuyển đổi bisulfite cho DNA được tách chiết từ mẫu mô cố định fomaldehyd của bệnh nhân ung thư đại trực tràng 3.4. Phương pháp nghiên cứu 3.4.1. Phương pháp thu thập và đánh giá số liệu ung thư CRC ở bệnh viện K TW Thông tin dữ liệu lầm sàng của bệnh nhân được thu thập, tổng hợp bằng phần mềm Excel 2010. Các chỉ tiêu: Giới tính, độ tuổi, giai đoạn phát hiện bệnh, tình trạng bệnh được tổng hợp, phân tích và đánh giá. 3.4.2. Phương pháp tách chiết DNA từ mẫu mô cố định formaldehyde 3.4.2.1. Lựa chọn phương pháp phù hợp để tiến hành tách chiết DNA Nhận thấy sự khó khăn trong việc tách chiết DNA từ mẫu mô cố định formaldehyde, nhóm nghiên cứu đã thử nghiệm tách chiết với 4 phương pháp hoàn toàn khác nhau để đưa ra những so sánh cụ thể: - Phương pháp 1: Tách chiết DNA từ mẫu mô cố định formaldehyde bằng phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit được thiết kế chuyên biệt cho việc tách chiết DNA từ mẫu mô cố định formaldehyd. - Phương pháp 2: Dựa trên phương pháp của Campos và Gilbert (2012) để tách chiết DNA từ mẫu gan cố định fomaldehyde.[14] . - Phương pháp 3: Nhận thấy sự khó khăn tương đồng giữa tách chiết DNA từ mẫu mô cố định fomaldehyde và tách chiết DNA từ móng tay, vì vậy nhóm nghiêm
  25. cứu đã thử nghiệm tách chiết DNA từ mẫu mô cố định fomaldehyde bằng phương pháp tách chiết DNA từ móng tay theo phương pháp của Alexander (2016).[15] - Phương pháp 4: Nhóm nghiên cứu thử nghiệm với một quy trình hoàn toàn tách biệt khi tách chiết DNA từ mẫu mô ngâm formaldehyde bằng phương pháp của Phòng nuôi cấy mô tế bào động vật – Viện Công nghệ sinh học – Viện khoa học công nghệ Việt Nam được thiết kế để tách chiết DNA từ mẫu lá tươi.[3] Bảng 3.3: Bố trí thí nghiệm tách chiết DNA với bốn phương pháp Campos và Alexander Phương pháp NaOH 2N Bộ KIT Gilbert (2012) (2016) Kí hiệu A B C Bộ KIT Số lượng mẫu 8 8 8 8 Khối lượng (mg) 25 25 25 25 Phương pháp 1: Tách chiết DNA từ mẫu mô cố định formaldehyde bằng phương pháp A Bảng 3.4. Quy trình tách chiết DNA từ mẫu mô cố định formaldehyde bằng phương pháp A Bước 1 Cắt mẫu mô 25 mg, cho mẫu vào ống eppendorf 1,5 ml Bước 2 Rửa mẫu bằng GTE 3 lần trong 30 phút, sau đó tiếp tục rửa mẫu với cồn 100% trong 1 phút, cồn 70% trong 5 phút, cồn 40% trong 5 phút, cồn 20% trong 5 phút và cuối cùng là rửa nước cất trong 10 phút, trong quá trình rửa cần đảo nhẹ ống eppendorf để rửa mẫu kỹ hơn Bước 3 Nghiền mẫu bằng que micropestle cho tới khi mẫu mô nát mịn hoàn toàn Bước 4 Bổ sung 500 µl dung dịch đệm alkali, đảo đều Bước 5 Ủ ở nhiệt độ 1000C trong 40 phút, cứ 10 phút lấy ra đảo đều bằng tay một lần Bước 6 Bổ sung dung dịch 25:24:1, đảo đều. Ly tâm 10.000 v/p trong 5 phút, thu dịch trên. Bước 7 Bổ sung cồn 100% với tỷ lệ 1:1, lắc nhẹ, ủ ở -200C trong ít nhất 2 tiếng Bước 8 Ly tâm ở 12.000 v/p trong 15 phút, sau đó loại bỏ dịch Bước 9 Tiếp tục bổ sung 750 µl cồn 70% ly tâm ở 12.000 v/p trong 1 phút để rửa tủa Bước 10 Loại bỏ dịch, để ống eppendorf có chứa DNA ở nhiệt độ phòng trong 10 phút Bước 11 Bổ sung 50 µl dd TE buffer và bảo quản trong -200C
  26. Phương pháp 2: Tách chiết DNA từ mẫu mô người cố định formaldehyde bằng phương pháp B Bảng 3.5. Quy trình tách chiết DNA từ mẫu mô người cố định formaldehyde bằng phương pháp B Bước 1 Cắt mẫu mô có khối lượng 125 mg, cắt nhỏ sau đó cho mẫu vào ống eppendorf 1,5 ml Bước 2 Rửa mẫu bằng GTE 3 lần trong 30 phút, sau đó tiếp tục rửa mẫu với cồn 100% trong 1 phút, cồn 70% trong 5 phút, cồn 40% trong 5 phút, cồn 20% trong 5 phút và cuối cùng là rửa nước cất trong 10 phút, trong quá trình rửa cần đảo nhẹ ống eppendorf để rửa mẫu kỹ hơn Bước 3 Bổ sung 500 µl lysis bufer Bước 4 Bổ sung 2,5 µl Proteinase K, sau đó mix mạnh bằng máy votex Bước 5 Ủ mẫu ở 560C trong 10 giờ Bước 6 Bổ sung 2 µl Rnase, mix nhẹ. Ủ trong 370C trong 1 giờ Bước 7 Bổ sung CIAA tỉ lệ 1: 1, mix nhẹ. Ly tâm 12000 v/p trong 15 phút Bước 8 Thu pha trên (xấp xỉ 400 µl) Bước 9 Bổ sung cồn tuyệt đối tỉ lê 1:1, sau đó ủ ở -200C trong 2 giờ Bước 10 Sau đó, Ly tâm 10000 v/p trong 10 phút, loại bỏ dịch thu cặn Bước 11 Bổ sung 1000 µl cồn 700, ly tâm 12.000 v/p trong 1 phút Bước 12 Loại bỏ dịch, để khô ở điện kện phòng thí nghiệm trong 10 phút. Bước 13 Bổ sung 50 µl dd TE buffer. Bảo quản ở -200C
  27. Phương pháp 3: Tách chiết DNA từ mẫu mô người cố định formaldehyde bằng phương pháp C Bảng 3.6. Quy trình tách chiết DNA từ mẫu mô người cố định formaldehyde bằng phương pháp C Bước 1 Cắt mẫu mô có khối lượng khoảng 25 mg, cho mẫu vào ống eppendorf 1,5 ml Bước 2 Rửa mẫu bằng GTE 3 lần trong 30 phút, sau đó tiếp tục rửa mẫu với cồn 100% trong 1 phút, cồn 70% trong 5 phút, cồn 40% trong 5 phút, cồn 20% trong 5 phút và cuối cùng là rửa nước cất trong 10 phút, trong quá trình rửa cần đảo nhẹ ống eppendorf để rửa mẫu kỹ hơn Bước 3 Bổ sung 200 µl NAOH 2N vào mẫu, ủ 12 giờ ở 370C Bước 4 Votex cho đến khi tan hoàn toàn. Bước 5 Trung hòa dịch dến pH = 6,8 kiểm tra bằng cách nhỏ 1 µl dịch mẫu lên giấy pH. Sử dụng HCl 12N để điều chỉnh PH (mỗi lần nhỏ khoảng 1-3 µl) sau đó vortex ngay lập tức. Nếu pH quá thấp thì tủa sẽ hình thành, chỉnh pH với NaOH nếu cần thiết để làm tan tủa Bước 6 Bổ sung dd Phenol/ Choloroform/ Isoamylakihol (25:24:1) tỷ lệ 1:1 vào dịch trung hòa, votex và li tâm 12000 v/p trong 5 phút, chuyển dịch lớp trên sang ống eppendorf mới. Bước 7 Tủa DNA bằng cách bổ sung cồn 95% với tỷ lệ 2:1, đảo đều và ủ ở - 20ºC trong ít nhất 2 tiếng. Bước 8 Ly tâm 12000 v/p trong 15-30 phút, loại dịch và để khô tủa Bước 9 Bổ sung 50 µl dd TE buffer và bảo quản ở -200C
  28. Phương pháp 4: Tách chiết DNA từ mẫu mô người cố định formaldehyde bằng phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit. Bảng 3.7. Quy trình tách chiết DNA từ mẫu mô người cố định formaldehyde bằng bộ Tissue Genomic DNA Extraction Mini Kit [Theo hướng dẫn nhà sản xuất FavorPrep] Bước 1 Cắt mẫu mô có khối lượng khoảng 25 mg, cho mẫu vào ống eppendorf 1,5 ml Bước 2 Rửa mẫu hai lần với dd PBS mỗi lần 1ml trong 10 phút để rửa sách formaldehy và các chất bẩn Bước 3 Nghiền mẫu bằng que micropestle cho tới khi mẫu mô nát mịn hoàn toàn Bước 4 Thêm 200 µl bộ đệm FATG1 và trộn đều trong lúc nghiền Bước 5 Thêm 20 µl proteinase K (10 mg/ml) vào hỗn hợp, đảo đều bằng máy votex Bước 6 Ủ trong bể ổn nhiệt ở 600C cho đến khi mô được tan hoàn toàn (1- 3h), mix nhẹ bằng tay trong quá trình ủ (30 phút 1 lần). Bước 7 Thêm 4 µl (100mg/ml) Rnase A, lắc đều bằng tay và để ở nhiệt độ phòng trong 2 phút Bước 8 Thêm 200 µl bộ đệm FATG 2 vào hỗn hợp mẫu, sau đó ủ trong bể ổn nhiệt ở 700C trong 10 phút Bước 9 Thêm 200 µl cồn 100% vào hỗn hợp mẫu, lắc đều bằng tay. Sử dụng máy spindown để những giọt dụng dịch còn dính bên thành ống dồn hết xuống đáy. Bước 10 Đặt cột mini FATG vào trong ống eppendorf mới, chuyển hỗn hợp ở ống cũ (bao gồm cả tủa) sang cột mini FATG. Sau đó ly tâm ở tốc độ 12000v/p trong 3 phút, ly tâm xong loại bỏ hết phần dịch. Bước 11 Thêm 400 µl W1 buffer vào cột mini FATG, ly tâm ở tốc độ tối đa trong 2 phút, sau đó loại bỏ dịch. Bước 12 Thêm 750 µl WASH buffer vào cột mini FATG, ly tâm ở tốc độ tối đa trong 1 phút. Sau đó loại bỏ dịch Bước 13 Ly tâm ở tốc độ tối đa thêm 3 phút, làm khô cột Bước 14 Thêm 50 µl Elution buffer hoặc nước có PH (7,5-9) vào màng của cột mini FATG (đặt sang ống eppendorf mới) . Để đứng cột trong 3p, DNA từ màng sẽ rơi xuống ống (lưu ý khi nhỏ elution buffer cần nhỏ chính xác vào màng). Bước 15 Ly tâm ở tốc độ tối đa trong 2 phút để dd Elution buffer có chứa DNA từ màng sẽ rơi xuống ống eppendorf Bước 16 Bảo quản DNA ở nhiệt độ -200C Phương pháp điện di kiểm tra chất lượng DNA
  29. Kiểm tra kích thước và độ nguyên vẹn của DNA bằng phương pháp điện di trên gel Agarose. - Đun gel agarose 1%, để cho gel nguội đến khoảng 600C - Đổ gel vào khuôn có cài sẵn răng lược cho gel đông lại - Nhấc lược ra, đặt bản gel vào bể điện di - Đổ dung dịch TAE 1X vào bể điện di - Trộn mẫu cần điện di với đệm tra mẫu (Loading dye) với tỷ lệ mẫu và đệm là 5µl :1µl, sau đó tra vào giếng. Dung dịch đệm mẫu có tác dụng làm tăng trọng lượng riêng của acid nucleic, vì vậy nó sẽ kéo phân tử acid nucleic lắng xuống đáy giếng. - Tiến hành chạy điện di ở 100V. Quan sát khi mẫu chạy được 2/3 bản gel thì tắt máy, nhấc bản gel ra và nhuộm trên dung dịch Ethidium Bromide khoảng 5-10 phút, với gel ra rửa qua nước và đặt lên máy soi gel để quan sát các băng DNA hoặc chụp ảnh. - Thuốc nhuộm Ethidium Bromide có tác dụng phát huỳnh quang dưới ánh sáng tia tử ngoại giúp cho việc hiện hình các băng rõ hơn. - Soi gel bằng máy soi gel Wealtec corp hoặc máy phân tích hình ảnh. Phương pháp đánh giá nồng độ và chất lượng DNA bằng máy đo độ quang phổ Nanodrop One Từ các hình ảnh điện di, kết quả đo độ quang phổ. So sánh và đưa ra phương pháp phù hợp nhất cho quy trình tách chiết DNA từ mẫu mô cố định fomaldehyd của bệnh nhân ung thư đại trực tràng. 3.4.2.2. Tiến hành tối ưu hoá quy trình tách chiết DNA từ mẫu mô cố định formaldehyde dựa trên cơ sở của phương pháp B. Nhận thấy nồng độ DNA còn thấp và độ đứt gãy trong sản phẩm tách chiết bằng phương pháp B 16 còn cao nên nhóm nghiên cứu quyết tối ưu hoá quy trình bằng các: - Tăng khối lượng mẫu mô từ 25 mg lên 125 mg - Băm nhỏ mẫu sau khi tiến hành cân và trước khi tiến hành rửa mẩu nhằm mục đích rửa mẫu sạch hơn và rút ngắn thời phá huỷ thành tế bào. - Giảm tốc độ ly tâm từ 13.000 v/p xuống 12.000 v/p ở bước 7 và bước 11.
  30. - Kiểm tra chất lượng DNA tách chiết từ mẫu mô cố định formaldehyde bằng phương pháp chạy điện di gel agarose và đo độ quang phổ Nanodrop One. - Thống kê kết quả đo độ quang phổ Nanodrop One bằng phần mềm Excel 2016. - Phân tích mẫu DNA từ hình ảnh và kết quả đo độ quang phổ Nanodrop. - Nhận xét kết quả để đưa ra quy trình tối ưu nhất cho tách chiết DNA từ mẫu mô cố định formaldehyde. 3.4.2.3. Tách chiết DNA số lượng mẫu mô cố định formaldehyde với quy trình đã được tối ưu và phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit Bảng 3.8 : Bố trí thí nghiệm tách chiết DNA từ mẫu mô cố định formaldehyde của bệnh nhân ung thư đại trực tràng Phương pháp Bộ KIT B Số mẫu 43 84 Khối lượng mẫu (mg) 25 125 3.4.3. Thiết kế mồi PCR đặc hiệu methyl hoá bằng phương pháp thiết kế Insilicon Phương pháp thiết kế mồi in silico là thuật ngữ dùng để mô tả thí nghiệm sinh học hoàn toàn được thực hiện trên máy tính. Sự phát triển nhanh của công nghệ trong vài thập kỷ qua khiến phương pháp in silico ngày càng được áp dụng rộng rãi trong sinh học. Phương pháp insilico có một số ưu điểm như: độ chính xác cao hơn và chất lượng tốt hơn thục nghiệm, hỗ trợ tốt hơn cho nghiên cứu chuyên sâu và truy cập vào các dữ liệu thực nghiệm được tạo ra bởi cộng đồng khoa học, mô phỏng chính xác các mô hình phức tạp hơn; thí nghiệm nhanh hơn cá nhân, năng suất làm việc cao hơn. Hiện nay, có hàng ngàn công cụ được phát triển và ứng dụng để giải quyết các bài toán. Tuy nhiên mỗi công cụ có thể là một chương trình máy tính đơn lẻ, hay cũng có thể là một công cụ nhỏ được tích hợp vào một trang mạng. Mỗi một công cụ có một công cụ thuật toán riêng nên cũng có những điểm mạnh khác nhau, ở nghiên cứu này chúng tôi sử dụng các công cụ sau: - Thu thập thông tin gen SEPT9 (vị trí gene, kích thước gene, ) từ trang web “Gene Cards The human Database”. - Truy xuất trình tự gene SEPT9 từ trang web ”Ensembl.”
  31. - Xác định trình tự promoter của gene SEPT9 từ trang web “Eukaryotic Promoter Database”. - Thiết kế cặp mồi PCR đặc hiệu methyl hoá bằng công cụ “Meth Primer”. 3.4.4. Quá trình chuyển hoá bisulfite cho mẫu DNA. 3.4.4.1. Xác định chất lượng DNA để chuẩn bị cho quá trinh bisufite Kiểm tra chất lượng DNA qua thí nghiệm: Chạy PCR mẫu DNA đã tách chiết được từ mẫu mô cố định formaldehyde của bệnh nhân ung thư đại trực tràng với cặp mồi gen FAT1. Bố trí thí nghiệm: - Khuếch đại gen FAT1 trên mẫu DNA kí hiệu số 50216 L ( mẫu mô cố định formaldehyde của bệnh nhân ung thư đại trực tràng ) ở các điều kiện nồng độ DNA khác nhau. - Khuếch đại gene RBCL trên mẫu DNA được tách chiết từ lá cây dong riềng đỏ nhằm mục đích xác định độ tin cậy của hoá chất phản ứng. Thí nghiệm 1: Bảng 3.9: Bố trí thí nghiệm Dong riềng đỏ Tên mẫu DNA 50216 L ( Nồng độ DNA: 514,8 ng/µl ) ( đ/c) Nồng độ DNA 1: 1 1: 10 1:100 1:1.000 1:10.000 Căp mồi RBCL FAT1 FAT1 FAT1 FAT1
  32. Bảng 3.10: Thành phần phản ứng PCR Hoá chất Thể tích ( 1 phản ứng ) DNA template 1 µl Primer F 1 µl Primer R 1 µl Taq 0,075 µl Buffer 10X 1,5 µl dNTP 10mM 0,3 µl H20 10,125 µl Tổng thể tích 15 µl Trộn đều các thành phần phản ứng sau đó đưa vào máy PCR với chu kỳ nhiệt như sau: o o o 95 C 95 C 72 C 72oC 60oC 0:30 3:00 1:30 10:00 4oC 0:45 ∞ Hình 3.1: Chu trình nhiệt của phản ứng PCR khuếch đại gene FAT1 Sau khi chạy xong phản ứng PCR, kiểm tra sản phẩm bằng cách điện di trên gel agarose. Thí nghiệm 2: Sau khi thí nghiệm chưa PCR khuếch đại được gene FAT1, nhóm nghiên cứu tiếp tục tối ưu phản ứng PCR bằng cách thay đổi nhiệt độ gắn mồi. Chạy phản ứng PCR khuếch đại gene FAT1 trên mẫu DNA 50216 L (nồng độ DNA tỷ lệ 1 : 100) trên các điều kiện nhiệt độ gắn mồi khác nhau. Bố trí thí nghiệm:
  33. Bảng 3.11: Thành phần phản ứng PCR Hoá chất Thể tích ( 1 phản ứng ) DNA template 1 µl Primer F 1 µl Primer R 1 µl Taq 0,075 µl Buffer 10X 1,5 µl dNTP 10mM 0,3 µl H20 10,125 µl Tổng thể tích 15 µl Trộn đều các thành phần phản ứng sau đó đưa vào máy PCR chạy với chu kỳ như sau: o 64 C o 62 C 60oC o o o 58 C o 95 C 95 C 72 C 72oC 56oC 54oC 3:00 0: 30 0:45 10:00 4oC 0:45 ∞ Hình 3.2: Chu trình nhiệt chạy PCR khuếch đại gene FAT1 Ở chu trình nhiệt trên nhóm nghiên cứu có thay đôi thời gian kéo dài mồi để phù hợp với chiều dài của gene là 695 bp. Sau khi chạy xong phản ứng PCR, kiểm tra sản phẩm bằng cách điện di trên gel agarose
  34. Thí nghiệm 3: Tiếp tục kiểm tra chất lượng cặp mồi FAT1 khi khuếch đại gene FAT1 trên mẫu DNA được tách chiết từ mẫu mô tươi (mẫu mô tuyến giáp). Bố trí thí nghiệm: Bảng 3.12: Bố trí thí nghiệm chạy PCR khuếc đại gene FAT1 Tên mẫu DNA Sản phẩm DNA tách từ mẫu mô tươi ở tuyến giáp của người Nồng độ DNA 1: 10 1:100 1:1.000 1:10.000 Cặp mồi FAT1 FAT1 FAT1 FAT1 Trộn đều các thành phần phản ứng sau đó đưa vào máy PCR chạy với chu kỳ như sau o o o 95 C 95 C 72 C 72oC 60oC 3:00 0:30 0:45 10:00 4oC 0:45 ∞ Hình 3.3 : Chu trình nhiệt phản ứng PCR khuếch đại gene FAT1 18 3.4.4.2. Thực hiện quá trình chuyển hoá bisulfite bằng phương pháp sử dụng bộ KIT EZ DNA Methylation – Gold (Zymo Research) - Hút 130 µl dd CT Conversion Reagent và 20 µl dd có chứa mẫu DNA (lưu ý để có kết quả tốt nhất lượng mẫu DNA thường có tổng nồng độ từ 500 pg – 2 µg) vào ống eppendorf 200 µl. Trộn đều bằng cách spindown. - Đặt mẫu vào bể ổn nhiệt theo chu kỳ: 980C trong 10 phút 640C trong 2,5 giờ 40C trong 20 giờ
  35. - Bổ sung 60 µl M-Binding buffer vào cột IC Zymo – spin TM có chứa và đặt cột vào ống eppendorf 1,5 ml - Lấy hỗn hợp dung dịch chứa mẫu DNA đã được ủ ở bước 2, cho vào cột IC Zymo – spin TM có chứa bộ đệm M- Biding. Đóng nắp và mix đều bằng tay. - Ly tâm ở 12.000 v/p trong 30 giây, loại bỏ dịch trên. - Bổ sung thêm 100 µl M – Wash buffer vào cột, ly tâm 12.000 v/p trong 30 giây. - Bổ sung thêm 200 µl M- Desulphonation buffer vào cột và để ở nhiệt độ phòng (200C – 300C) trong 15 – 20 phút. Sau đó ly tâm 12.000 v/p trong 30 giây. - Bổ sung 200 µl M – Wash buffer vào cột và ly tâm 12.000 v/p trong 30 giây. Bổ sung thêm 200 µl M – Wash buffer vào ly tâm 12000 v/p trong 30 giây. - Đặt cột vào ống eppendorf 1,5 ml. Bổ sung 10 µl M – Elution buffer (nhỏ trực tiếp lên màng lọc). Và ly tâm 12.000 v/p, thu dịch ở ống eppendorf (sản phẩm DNA dã qua quá trình bisulfite).
  36. Phần 4 KẾT QUẢ VÀ THẢO LUẬN 4.1. Kết quả thu thập và phân tích số liệu lâm sàng trên 151 mẫu bệnh phẩm của bệnh nhân ung thư đại trực tràng được thu thập ngẫu nhiên tại bệnh viện K TW Nhóm nghiên cứu đã thu thập được 151 mẫu mô đi kèm với phiếu kết quả xét nghiệm lâm sàng của bệnh nhân ung thư đại trực tràng. Nhận thấy 151 có thể là con số đủ lớn cho việc phân tích số liệu lâm sàng của bệnh nhân. Chúng tôi tiến hành phân tích dữ liệu của 151 phiếu xét nghiệm lâm sàng. 4.1.1. Kết quả phân tích về độ tuổi phát hiện ung thư Bảng 4.1: Thống kê về độ tuổi phát hiện bệnh ung thư đại trực tràng Độ tuổi 30 - 50 50 - 59 60 – 69 Trên 70 Tổng số Số lượng 29 49 42 31 151 Tỷ lệ (%) 19,20 32,45 27,81 20,54 100 Từ kết quả bảng 4.1 cho thấy: Phân tích trên 151 phiếu xét nghiệm lâm sàng được thu thập ta thấy rằng, bệnh nhân ở độ tuổi 50 - 59 có tỷ lệ cao nhất (32,45%), sau đó là độ tuổi 60 - 69 (27,81%) tiếp đến là độ tuổi trên 70 (20,54%) và thấp nhất là độ tuổi 30 - 50 (19,2%). Đặc biệt không có bệnh nhân ung thư đại trực tràng dưới 30 tuổi trong thống kê này. Các tỷ lệ ở bảng 4.1 cho thấy hoàn toàn trùng hợp với số liệu của tổ chức y tế WHO đã đưa ra năm 2018: Bệnh nhân ung thư đại trực tràng ở những người trên 50 tuổi chiếm tỷ lệ cao. 1 4.1.2. Kết quả phân tích về giới tính Bảng 4.2 : Thống kê giới tính của bệnh nhân ung thư đại trực tràng Giới tính Số lượng Tỷ lệ (%) Nam 88 58,3 Nữ 63 41,7 Nhận xét:
  37. Theo bảng 4.2, ta thấy tỷ lệ nam giới mắc bệnh (58,3%) gấp 1,39 lần so với nữ giới (41,7%). Thống kê này tương đồng với kết quả của WHO đã công bố: Tỷ lệ mắc ung thư đại trực tràng ở nam giới cao hơn ở nữ giới.[18] 4.1.3. Kết quả phân tích về giai đoạn phát hiện bệnh Bảng 4.3: Thống kê về giai đoạn phát hiện bệnh Giai đoạn phát I II III IV Tổng số hiện bệnh Số lượng 18 77 54 2 151 Tỷ lệ (%) 11,92 50,99 35,76 1,33 100 Nhận xét: Thống kê lâm sàng ngẫu nhiên trên 151 bệnh nhân ung thư đại trực tràng tại bệnh viện K TW cho thấy, hầu hết các bệnh nhân ung thư đại trực tràng được phát hiện khi đã bước vào giai đoạn II và III của ung thư đại trực tràng lần lượt là 77 bệnh nhân (chiếm 50,99%) và 54 bệnh nhân (chiếm 35,76%), có 18 bệnh nhân (chiếm 11,92%) phát hiện được sớm ung thư ngay ở giai đoạn I của bệnh và 2 bệnh nhân được phát hiện đã bước vào giai đoạn IV của ung thư đại trực tràng. Có thể thấy tỷ lệ bệnh nhân ung thư đại trực tràng phát hiện bệnh ngay khi bệnh khởi phát là thấp. 4.1.4. Khảo sát về giai đoạn của bệnh khi phát hiện Bảng 4.4: Thống kê tỷ lệ phát hiện bệnh khi đã bị di căn của nghiên cứu này và tỷ lệ tương tự của Hoa Kỳ (được công bố bởi Hiệp hội ung thư Hoa Kỳ) Nghiên cứu này Hoa Kỳ Giai đoạn Số lượng Tỷ lệ (%) Tỷ lệ(%) Đã di căn 57 38 58 Chưa di căn 93 62 42 Qua bảng 4.4 ta thấy, tỷ lệ số người trong 151 phiếu xét nghiệm lâm sàng khi phát hiện bệnh ung thư đại trực tràng đã qua giai đoạn di căn tại nghiên cứu này là 57 người (chiếm 38%) và tỷ lệ này tại Hoa Kỳ là 58%. Cũng theo WHO, tỷ lệ bệnh nhân
  38. mắc ung thư đại trực tràng ở Việt Nam là 13,4 : 100.000 người và ở Hoa Kỳ là 25,6 : 100.000 người.Có thể thấy, cả tỷ lệ mắc ung thư đại trực tràng và tỷ lệ phát hiện ra bệnh ở giai đoạn đã di căn của Hoa Kỳ đều cao hơn nghiên cứu này.[18] 4.2. Kết quả tách chiết DNA Phương pháp bảo quản mẫu mô được sử dụng phổ biến nhất cho các ứng dụng y học và sinh học là cố định fomaldehyde. Phương pháp này cho phép giữ được cấu trúc của mô, hình dạng tế bào và các thành phần của tế bào (protein, carbohydrate, ). Tuy nhiên, khi mẫu mô được cố định formaldehyde trong thời gian dài sẽ gây ra sự phá vỡ các liên kết trong chuỗi nucleotide – DNA, gây khó khăn cho quá trình tách chiết DNA.19 Hình 4.1. DNA được tách chiết từ mẫu mô cố định formaldehyde được tách chiết từ bộ KIT chuẩn của công ty Clini Sciences - DNA Storm: DNA được tách chiết từ mẫu mô cố định Formadehyd do công ty CliniSciences tách chiết bằng bộ DNAstorm DNA FFPE Extraction Kit
  39. - KIT R: DNA được tách từ mẫu mô cố định formaldehyde do công ty Clini Sciences tách chiết bằng bộ KIT R (bộ KIT cạnh tranh trên thị trường với công ty Clini Sciences) Theo hình 4.1. Trên hai đường chạy là sản phẩm DNA được tách chiết từ mẫu mô cố định formaldehyde bằng hai phương pháp sử dụng bộ kít được thiết kế chuyên biệt cho quá trình tách DNA từ mẫu mô cố định formaldehyde (được xem là những bộn KIT đạt chuẩn). Từ đó ta có thể thấy rằng, tách chiết DNA từ mẫu mô cố định formaldehyde bằng nhưng phương pháp hiện đại và tối ưu hiện nay, sản phẩm DNA được tách ta bị đứt gãy nhiêu, kích thước ngắn, nhiều tạo thành vệt smear. 4.2.1. Kết quả lựa chọn phương pháp phù hợp tách chiết DNA từ mẫu mô cố định formaldehyde 4 2.1.1. Kết quả điện di M 1 2 3 4 Hình 4.2: Kết quả điện di sản phẩm DNA được tách từ 4 phương pháp A, B, C và bộ KIT
  40. - M: Gene Ruler 1kb - Đường chạy 1: Sản phẩm DNA được tách chiết bằng phương pháp A 15 - Đường chạy 2: Sản phẩm DNA được tách chiết bằng phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit. - Đường chạy 3: Sản phẩm DNA được tách chiết bằng phương pháp B 16 - Đường chạy 4: Sản phẩm DNA được tách chiết bằng phương pháp C 17 Từ kết quả trên hình 4.2 cho thấy: Trong 4 phương pháp được thử nghiệm, phương pháp tách chiết bằng bộ KIT Tissue Genomic DNA Extraction Mini Kit tương ứng với đường chạy số 2 và phương pháp C 16 tương ứng với đường chạy số 3 nhìn thấy được sản phẩm DNA. Tuy nhiên chất lượng DNA không ổn định, sản phẩm thu được bị đứt gãy nhiều, tạo thành một vệt smear chạy dọc từ trên xuống dưới. Kết quả tách chiết cũng cho thấy, mẫu mô cố định formaldehyde bị đứt gãy nhiều, cường độ sáng tập trung ở kích thước 250bp – 500bp. Hai phương pháp A 15 tương ứng với đường chạy số 1 và phương pháp C 16 tương ứng với đường chạy số 4 cho thấy không xuất hiện băng vạch hay smear. So sánh với hình 4.2 với hình 4.1 ta thấy rằng sản phẩm DNA được tách chiết từ phương pháp B 16 và phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit có chất lượng ở mức chấp nhận được. 4.2.1.2. Kết quả đo độ quang phổ bằng máy Nanodrop One Bảng 4.5 : Kết quả đo nồng độ DNA Nồng độ DNA (ng/µl) Dưới 50 50 - 100 100 - 500 Trên 500 Tổng Phương Số Tỷ Số Số Số Tỷ số pháp Tỷ lệ Tỷ lệ lượng lệ lượng lượng lượng lệ mẫu (%) (%) mẫu (%) mẫu mẫu mẫu (%) A 0 0 0 0 4 50 4 50 8 B 1 12,5 4 50 3 37,5 0 0 8 C 0 0 0 0 3 37,5 5 62,5 8 Bộ KIT 1 12,5 6 75 1 12,5 0 0 8
  41. Từ bảng 4.5 , ta có thể thấy: - Sản phẩm DNA được tách chiết từ phương pháp A 15 có 4 mẫu (chiếm 50%) có nồng độ DNA từ 100 - 500 (ng/µl) và 4 mẫu (chiếm 50%) có nồng độ DNA trên 500 (ng/µl). - Sản phẩm DNA được tách chiết từ phương pháp sử dụng B 16 có 1 mẫu (chiếm 12,5 %) có nồng độ DNA dưới 50 (ng/µl); 4 mẫu ( chiếm 50%) có nồng độ DNA từ 50 – 100 (ng/µl); 3 mẫu (chiếm 37,5%) có nồng độ từ 100 – 500 (ng/µl). - Sản phẩm DNA được tách chiết từ C 17 cho ra 3 mẫu ( chiếm 37,5%) có nồng độ DNA từ 100 - 500 (ng/µl); 5 mẫu (chiếm 62,5%) có nồng độ từ trên 500 (ng/µl). - Sản phẩm DNA được tách chiết từ bộ KIT Tissue Genomic DNA Extraction Mini Kit cho ra 1 mẫu (chiếm 12,5%) có nồng độ DNA dưới 50 (ng/µl); 6 mẫu (chiếm 75%) có nồng độ từ 50 – 100 (ng/µl) và 1 mẫu có nồng độ DNA từ 100 – 500 (ng/µl). Qua bảng 4.5 và hình 4.1 ta thấy nồng độ DNA và kích thước (độ đứt gãy) của DNA không có sự tương đồng với nhau. Ở hai phương pháp A và C cho ra nồng độ DNA cao hơn, tuy nhiên khi được điện di trên đường chạy sản phẩm DNA của hai phương pháp không nhìn thấy rõ băng, vạch hay. Ngược lại, kết quả nồng độ DNA của sản phẩm được tách chiết từ hai phương pháp sử dụng bộ KIT và phương pháp B cho ra nồng độ thấp hơn nhưng khi điện di ta có thể thấy rõ được sản phẩm DNA. 4.2.1.3. Kết quả đo tỷ số OD260/280 Bảng 4.6 : Kết quả đo tỷ số OD260/280 Tỷ số OD260/280 Phương Dưới 1,6 1,6 – 1,79 1,8 - 2 Trên 2 Tổng số pháp Số Tỷ lệ Số Tỷ lệ Số Tỷ lệ Số Tỷ lệ mẫu mẫu (%) mẫu (%) mẫu (%) mẫu (%) A 6 75 2 25 0 0 0 0 8 B 6 75 2 25 0 0 0 0 8 C 5 62,5 3 37,5 0 0 0 0 8 Bộ KIT 5 62,5 3 37,5 0 0 0 0 8 Từ bảng 4.6, ta thấy rằng: - Sản phẩm DNA được tách chiết từ phương pháp A cho ra 6 mẫu (chiếm 75%) có tỷ số OD260/280 dưới 1,6; 2 mẫu (chiếm 25%) có tỷ số OD260/280 từ 1,6 – 1,79 và
  42. không có mẫu nào có tỷ số OD260/280 từ 1,8 – 2 (khoảng OD260/280 được cho phép là mức độ đạt tiêu chuẩn không chứa tạp chất và protein). - Sản phẩm DNA được tách chiết từ phương pháp B 16 cho ra 6 mẫu (chiếm 75 %) có tỷ số OD260/280 dưới 1,6 ; 2 mẫu (chiếm 25%) có tỷ số OD260/280 từ 1,6 – 1,79. - Sản phẩm DNA được tách chiết từ phương pháp C 17 có 5 mẫu (chiếm 62,5%) có tỷ số OD260/280 dưới 1,6 ; 3 mẫu (chiếm 37,5%) có tỷ số OD260/280 từ 1,6 – 1,79. - Sản phẩm DNA được tách chiết từ phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit cho ra 5 mẫu (chiếm 62,5%) có tỷ số OD260/280 dưới 1,6 ; 3 mẫu (chiếm 37,5%) có tỷ số OD260/280 từ 1,6 – 1,79. - Tách chiết DNA từ mẫu mô cố định formaldehyde bằng cả bốn phương pháp đều cho ra sản phẩm có tỷ số OD260/280 dưới mức 1,8 – 2 (mức độ cho phép với sản phẩm DNA tách chiết từ mẫu mô tươi, không bị lẫn tạp chất và protein), trong đấy tỷ số OD260/280 dưới 1,6 chiếm tỷ lệ cao. 4.2.1.4. Kết quả đo tỷ số OD260/230 Bảng 4.7 : Kết quả đo tỷ số OD260/230 Phương Tỷ số OD260/230 Tống số pháp Dưới 1,6 1,6 – 1,79 1,8 - 2 Trên 2 mẫu Số Tỷ lệ Số Tỷ lệ Số Tỷ Số Tỷ mẫu (%) mẫu (%) mẫu lệ mẫu lệ (%) (%) A 6 75 2 25 0 0 0 0 8 B 5 62,5 3 37,5 0 0 0 0 8 C 8 100 0 0 0 0 0 0 8 Bộ KIT 5 62,5 3 37,5 0 0 0 0 8 Từ bảng 4.7, ta thấy: - Sản phẩm DNA được tách chiết từ phương pháp A cho ra 6 mẫu (chiếm 75%) có tỷ số OD260/230 dưới 1,6; 2 mẫu có tỷ số OD260/230 từ 1,6 – 1,79 (chiếm 25%). - Tách chiết DNA từ mẫu mô cố định formaldehyde bằng phương pháp B 16 cho ra 4 mẫu có tỷ số OD260/230 dưới 1,6 (chiếm 50%); 3 mẫu có tỷ số OD260/230 (chiếm 37,5%).
  43. - Khi DNA được tách chiết bằng phương pháp B 17 cho ra 100 % các mẫu DNA đều có tỷ số OD260/230 dưới 1,6. - Tách chiết DNA từ mẫu mô cố định formaldehyde bằng phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit cho ra 5 mẫu có tỷ số OD260/230 dưới 1,6 (chiếm 62,5 %) và 3 mẫu có tỷ số OD260/230 từ 1,6 – 1,79. - Nhóm nghiên cứu nhận thấy rằng khi tách chiết DNA từ mẫu mô cố định formaldehyde từ các phương pháp trên đều cho ra tỷ lệ OD260/230 thấp hơn so với tỷ lệ đạt chuẩn của DNA mẫu tươi (1,8 – 2) và tỷ số OD260/230 dưới 1,6 ở cả 4 phương pháp đều chiếm tỷ lệ cao. Bảng 4.8: Kết quả mức độ nhiễm tạp chất và phenol trong mẫu DNA của bốn phương pháp Phương pháp Tỷ lệ (%) A 50 B 40,47 C 50 Bộ KIT 16,27 Từ bảng 4.8, ta thấy: - Nếu trong mẫu DNA template còn nhiễm tạp chất (1 số chất hoá học) và đặc biệt phenol sẽ làm biến tính polymerase dẫn đến ức chế quá trình PCR. Vì vậy kiểm tra mức độ nhiễm các tạp chất và phenol là vô cùng quan trọng cho quá trình PCR tiếp theo. - Tỷ lệ nhiễm tạp chất và phenol của các mẫu DNA được tách chiết từ mẫu mô cố định formaldehyde rất cao, lần lượt là 50% với phương pháp sử dụng A 15; 40,47% đối với phương pháp B; 16,27% với phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit và 50% với phương pháp C. - Phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit cho ra tỷ lệ sản phẩm bị nhiễm tạp chất và phenol thấp nhất, tiếp đến là phương pháp B.
  44. Bảng 4.9: Thống kê 4 phương pháp Nội dung Phương pháp Bộ KIT A B C Phá vỡ thành FATG1 SDS 1% SDS 1% NaOH 2N tế bào buffer Tinh sạch Cột silica Phenol/chloroform Chloroform Phenol/Chloroform DNA Thời gian (h) 3:30 5:50 16:00 15:00 Chi phí (VNĐ) 50.000 < 50,000 < 50,000 < 50,000 Từ kết quả điện di và đo độ quang phổ Nanodrop, nhóm nghiên cứu nhận thấy rằng : - Tuy nồng độ DNA của sản phẩm được tách chiết bằng phương pháp A và phương pháp C cao hơn nồng độ sản phẩm của hai phương pháp còn lại nhưng khi điện di không hiện rõ như sản phẩm DNA được tách chiết từ hai phương pháp B và phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit. - Tỷ số OD260/280 và OD260/230 của sản phẩm ở cả 4 phương pháp đều ở mức thấp hơn 1,8. - Tỷ lệ nhiễm tạp chất và phenol trong sản phẩm DNA thu được ở phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit và phương pháp sử dụng B 16 thấp hơn so với hai phương pháp A và phươg pháp C. Tỷ lệ nhiễm tạp chất rất quan trọng trong nghiên cứu này để có thể tiến hành các bước tiếp theo của nghiên cứu. - Qua hình điện di nhóm nghiên cứu nhận thấy rằng kích thước và nồng độ DNA tách chiết bằng phương pháp B 16 và phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit được xem là chấp nhận được nếu so sánh với DNA được tách chiết từ bộ KIT DNA storm DNA FFPE Extraction Kit và bộ KIT R (hai bộ KIT được xem là chuẩn trên thế giới) do công ty Clini Sciences tách chiết. Từ những nhận xét trên nhóm nghiên cứu tiến hành tối ưu hoá quy trình tách chiết DNA cố định ngâm fomaldehyde bằng phương pháp B.
  45. 4.2.2. Kết quả tối ưu quy trình tách chiết DNA từ mẫu mô cố định formaldehyde 1 2 Hình 4.3: Kết quả điện di sản phẩm DNA được tách chiết từ mẫu mô 14173 - U phương pháp B Đường chạy số 1: Sản phẩm DNA được tách chiết bằng phương pháp B 16chưa tối ưu (nồng độ DNA : 150 ng/µl) Đường chạy số 1: Sản phẩm DNA được tách chiết bằng phương pháp B 16 đã tối ưu (nồng độ DNA: 936 ng/µl) Từ hình 4.3, ta có thể thấy: Sau khi tối ưu hoá quy trình tách chiết DNA từ mẫu mô cố định formaldehyde bằng phương pháp B 16 (đường chạy số 2) cho ra sản phẩm DNA có nồng độ cao hơn, cường độ ánh sáng cao hơn so với đường chạy số 1. Từ cơ sở trên nhóm nghiên cứu tiến hành tách chiết DNA từ số lượng lớn mẫu mô cố định formaldehyde của bệnh nhân ung thư đại trực tràng bằng phương B 16 sau khi đã được tối ưu và phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit vẫn được giữ nguyên quy trình. 4.2.3. Kết quả tách chiết DNA từ mẫu mô cố định formaldehyde bằng B đã tối ưu và phương pháp sử dụng Tissue Genomic DNA Extraction Mini Kit 4.2.3.1. Kết quả do nồng độ DNA
  46. Bảng 4.10 : Kết quả đo nồng độ DNA Nồng độ DNA (ng/µl) Dưới 100 100 - 500 500 - 1000 Trên 1000 Tổng Phương Số Số Số Số số pháp Tỷ lệ Tỷ lệ Tỷ lệ Tỷ lệ lượng lượng lượng lượng mẫu (%) (%) (%) (%) mẫu mẫu mẫu mẫu Bộ KIT 39 90,69 4 9,31 0 0 0 0 43 B 9 10,72 29 34,52 17 20,24 29 34,52 84 Từ bảng 4.10, ta thấy : - Đối với phương pháp B khi tăng khối lượng mẫu để đưa vào quá trình tách chiết, nồng độ tăng lên theo tỷ lệ thuận với khối lượng. - Tách chiết DNA bằng phương pháp B cho ra 29 mẫu có nồng độ DNA trên 1000 (ng/µl) (chiếm 34, 52%) trong khi ở thí nghiệm 1 (tách chiết DNA bằng phương pháp B với khối lượng đưa vào là 25 mg) không có mẫu nào có nồng độ trên 1000 (ng/µl); 17 mẫu (chiếm 20,24%) có nồng độ DNA trong khoảng 500 – 1000 (ng/µl); 29 mẫu (chiếm 34,52%) có nồng độ DNA trong khoảng 100 – 500 và 9 mẫu có nồng độ dưới 100 (ng/µl) (chiếm 10, 72%). - Tách chiết DNA bằng phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit cho thấy tỷ lệ nồng độ DNA không thay đổi quá nhiều so với thí nghiệm 1, chứng tỏ khi tách chiết bằng bộ KIT này cho ra tính ổn định cao.
  47. 4.2.3.2. Kết quả đo tỷ số OD260/280 Bảng 4.11: Kết quả đo tỷ số OD260/280 Tỷ số OD260/280 Dưới 1,6 1 - 1,79 1,8 - 2 Trên 2 Phương Tổng Tỷ Tỷ pháp Số Tỷ lệ Số Tỷ lệ Số Số số mẫu lệ lệ lượng (%) lượng (%) lượng lượng (%) (%) Bộ KIT 30 69,77 12 27,90 0 0 1 2,33 43 Lysis buffer 78 92,86 5 5,95 1 1,19 0 0 84 Từ bảng 4.11, ta có thể thấy: - Đối với tách chiết DNA bằng phương pháp B, khối lượng mẫu tăng (từ 25 mg đến 125 mg) nhưng tỷ lệ tỷ số OD260/280 không thay đổi. Ta có thể khẳng định tỷ số OD260/280 không phụ thuộc vào lượng mẫu đưa vào quá trình tách chiết. 4.2.3.3. Kết quả đo tỷ số OD260/230 Bảng 4.12: Kết quả đo tỷ số OD260/230 Phương Tỷ số OD260/230 Tổng pháp Dưới 1,6 1,6 - 1,79 1,8 - 2 Trên 2 số Số Tỷ lệ Số Tỷ lệ Số Tỷ lệ Số Tỷ lệ mẫu lượng (%) lượng (%) lượng (%) lượng (%) Bộ KIT 23 53.49 8 18.60 7 16.28 5 11.63 43 B 82 97.62 1 1.19 0 0.00 1 1.19 84 Từ bảng 4.12, ta thấy: - Đối với phương pháp sử dụng Lysis buffer sau khi tăng khối lượng mẫu, tỷ lệ số đo OD260/230 trong khoảng 1,8 – 2 vẫn không thay đổi, ta có thể khẳng định tỷ số OD260/230 không phụ thuộc vào khối lượng mẫu đưa vào tách chiết. - Tỷ lệ OD260/230 khi DNA được tách chiết từ 43 mẫu cố định formaldehyde cho thấy có 23 mẫu (chiếm 53,49%) dưới 1,6; 8 mẫu trong khoảng từ 1,6 – 1,79 (chiếm 18,60 %); 7 mẫu đạt tỷ số OD260/230 từ 1,8 – 2 ( tỷ số được coi không nhiễm
  48. tạp chất và các chất hoá học khác) chiếm 16,28 %; 5 mẫu có tỷ số OD260/230 trên 2 (chiếm 11,63%). Từ kết quả tách chiết DNA từ mẫu mô cố định formaldehyde, nhóm nghiên cứu có những nhận xét sau : - Sản phẩm DNA được tách chiết từ mẫu mô của bệnh nhân ung thư đại trực tràng được cố định trong formaldehyde trong thời gian dài có kích thước ngắn, nồng độ DNA thấp, so với sản phẩm DNA được tách chiết từ mẫu mô tươi. - Tỷ số OD260/280 và tỷ số OD260/230 của sản phẩm DNA tách chiết từ mẫu mô cố định formaldehyde đều trong khoảng dưới 1,8. - Phương pháp sử dụng bộ KIT Tissue Genomic DNA Extraction Mini Kit cho ra sản phẩm DNA có chất lượng ổn định nhất trong 4 phương pháp đã sử dụng. - Đối với tách chiết DNA từ mẫu mô cố định formaldehydee bằng phương pháp B 16 khối lượng thay đổi làm thay đổi nồng độ DNA nhưng không thay đổi tỷ số OD260/280 và tỷ số OD260/230. 4.3. Kết quả thiết kế mồi PCR đặc hiệu methyl hoá. Có rất nhiều phương pháp để xác định mức độ methyl hoá trên một chỉ thị phân tử hay một gene (ở nghiên cứu này là đánh giá mức độ methyl hoá trên vùng promoter của gene SEPT9). Tuy nhiên với điều kiện cơ sở vật chất hiện tại, nhóm nghiên cứu quyết định sử dụng phương pháp PCR đặc hiệu methyl hoá. Thiết kế mồi là một phần quan trọng trong quá trình PCR đặc hiệu methyl hoá. 4.3.1. Thu thập thông tin gene SEPT9 từ cơ sở dữ liệu database Hình 4.4: Vị trí và kích thước của gene SEPT9 - Gen SEPT9 nằm trên nhiễm sắc thể thứ 17 ở người từ 77,280,569 bp đến 77,500,596 bp với chiều dài 220,027 bp.[20] - Ta có thể trích xuất trình tự DNA từ công cụ Ensembl.
  49. 4.3.2. Xác định trình tự promoter trên gene SEPT9 Tìm kiếm promoter trên gene SEPT9 bằng cách tìm kiếm trên các bài báo đã được thực nghiệm.[21] Bảng 4.13 : Trình tự promoter trên gene SEPT9 Trình tự promoter trên gen SEPT9 Promoter ggcgggggcgcagcgcgcggggaggggccggcgcccgccttcctcccccattcattcagc 4.3.3. Thiết kế mồi PCR đặc hiệu methyl hóa Hình 4.5: Thiết kế mồi đặc hiệu methyl hoá Vị trí các đảo CpG nằm trùng hoặc xung quanh vị trí promoter của gene SEPT9 được thể hiện trên hình 4.5, từ đó thấy được 5 cặp mồi, vị trí của các cặp mồi trùng nhau hoặc gần nhau.[22] Nhóm nghiên cứu thiết kế được bộ mồi khuếch đại trình tự promoter của gene SEPT9: Cặp 1: Left M Primer: GATTTTGTTAGGGGTATTCGC Right M Primer: ATTTCCCAAAATAAAACTATACGTC Cặp 2: Left M Primer: GATTTTGTTAGGGGTATTTGTGT Right M Primer: ATTTCCCAAAATAAAACTATACATC
  50. 4.4. Kết quả chuyển hoá bisulfite đối với DNA được tách chiết từ mẫu mô cố định formaldehyde của bệnh nhân ung thư đại trực tràng 4.4.1. Kết quả chất lượng DNA chuẩn bị cho quá trình biến đổi bisufite Kết quả thí nghiệm 1: M đ/c 1 2 3 4 5 Hình 4.6: Kết quả chạy khuếch đại gene FAT1 M: Thang DNA chuẩn1 kb Đường chạy Đ/C: Sản phẩm khuếch đại gene RBCL trên mẫu DNA của dong riềng đỏ Đường chạy 1, 2, 3, 4, 5: Đường chạy khuếch đại gene FAT1 trên mẫu DNA 50216 L với các nồng độ DNA làn lượt là 1:1, 1:10, 1:100, 1:1.000, 1:10.000. Từ hình 4.6 , ta thấy : - Trên đường chạy đối chứng ta thấy sản phẩm khuếch đại của gene RBCL vẫn lên chứng tỏ rằng hoá chất sử dụng cho thí nghiệm này hoàn toàn đảm bảo. - Trên đường chạy 1, 2, 3, 4, 5 đều không thấy xuất hiện sản phẩm PCR . - Nhóm nghiên cứu kết luận rằng khi chạy phản ứng PCR khuếch đại gene FAT1 trên mẫu DNA ở các nồng độ DNA được pha loãng lần lượt là 1:1; 1: 10; 1 :100; 1 :1.000; 1: 10.000, đều không cho sản phẩm khuếch đại gene FAT1.
  51. Kết quả thí nghiệm 2: 1 2 3 4 5 6 M Hình 4.7: Kết quả PCR khuếch đại gene FAT1 Đường chạy M: Thang chuẩn DNA 1 kb Đường chạy 1, 2, 3, 4, 5,6: Nhiệt độ gắn mồi ở 54oC, 56 oC, 58 oC, 60 oC, 62 oC, 64 oC tương ứng Theo hình 4.7, ta thấy: Trên cả 6 đường chạy đều không thấy sản phẩm PCR gene FAT1. Có thể do mồi hoặc do chất lượng DNA tách chiết kém. Kết quả thí nghiệm 3: M 1 2 3 4 Hình 4.8: Kết quả PCR gen FAT1
  52. M: Gene ruler DNA 1kb Đường chạy 1, 2, 3, 4: Nồng độ DNA 1:10, 1: 100, 1: 1.000, 1: 10.000 tương ứng Theo hình 4.9, ta thấy: - Khuếch đại gene FAT1 trên mẫu DNA từ mẫu mô tươi (kết quả của mục 4.2.1) ở các điều kiện nồng độ được pha loãng 1: 1, 1: 10, 1: 100, 1: 1.000, 1: 10.000, tuy nhiên 4 đường chạy đều không có sản phẩm PCR, có thể do chất lượng cặp mồi không đảm bảo hoặc chưa tối ưu được phản ứng PCR. Kết quả: Do thời gian không cho phép nên em không tiếp tục tìm nguyên nhân và tối ưu phản ứng PCR kiểm tra được chất lượng mẫu DNA đã tách chiết từ mẫu mô cố định formaldehyde để chuẩn bị cho quá trình chuyển hoá bisufite. 4.4.2. Kết quả chuyển đổi Bisufite Do chưa đánh giá được chất lượng sản phẩm DNA tách chiết từ mẫu mô cố định formaldehyde của bệnh nhân ung thư đại trực tràng Việt Nam nên em chưa thực hiện được quá trình chuyển đổi bisulfite.
  53. Phần 5 KẾT LUẬN VÀ KIẾN NGHỊ 5.1. Kết luận - Thu thập và phân tích được số liệu của 151 bệnh nhân khám và điều trị tại bệnh viên K TW. - Tách chiết và phân tích được mẫu mô cố định formaldehyde của bệnh nhân ung thư đại trực tràng Việt Nam. - Thiết kế được bộ mồi PCR đặc hiệu methyl hoá. - Chưa đánh giá được chất lượng DNA để chuẩn bị cho quá trình biến đổi bisufite. 5.2. Kiến nghị - Tiếp tục tìm kiếm và tối ưu hoá phương pháp tách chiết DNA từ mẫu mô cố định formaldehyde của bệnh nhân ung thư đại trực tràng Việt Nam. - Tiếp tục đánh giá chất lượng sản phẩm DNA bằng cách tối ưu hoá phản ứng PCR gene FAT1 để tiến hành biến đổi bisufite.
  54. TÀI LIỆU THAM KHẢO Tài liệu tiếng Việt 1. ĐỨC, P. . & BÁ, S. N. Bài giảng ung thư học. NXB Y Học (2001). 2. Nội, Đ. họcY H. Giáo trình giải phẫu. (1998). 3. Phòng nuôi cấy mô tế bào động vật, Viện công nghệ sinh học, V. khoa học công nghệ V. N. 4. Nguyễn Thị Thanh Ngân1,*, N. T. K. L. et al. XÁC ĐỊNH ĐỘT BIẾN Q2933P TRÊN GEN FAT1 Ở BỆNH NHÂN BỊ THIỂU NĂNG TRÍ TUỆ TRONG MỘT GIA ĐÌNH CÓ NẠN NHÂN CHẤT ĐỘC DIOXIN Ở VIỆT NAM. Tạp chí Công nghệ Sinh học 16(2) 253-258, 2018 (2018). Tài liệu tiếng Anh 5. Song, L., Jia, J., Peng, X., Xiao, W. & Li, Y. The performance of the SEPT9 gene methylation assay and a comparison with other CRC screening tests: A meta- analysis. Sci. Rep. 7, (2017). 6. Klutstein, M., Nejman, D., Greenfield, R. & Cedar, H. DNA methylation in cancer and aging. Cancer Research vol. 76 3446–3450 (2016). 7. São Julião, G. P. et al. New Strategies in Rectal Cancer. Surgical Clinics of North America vol. 97 587–604 (2017). 8. Moore, L. D., Le, T. & Fan, G. DNA methylation and its basic function. Neuropsychopharmacology vol. 38 23–38 (2013). 9. Wajed, S. A., Laird, P. W. & DeMeester, T. R. DNA methylation: An alternative pathway to cancer. Annals of Surgery vol. 234 10–20 (2001). 10. Hariharan, R. & Jenkins, M. Utility of the methylated SEPT9 test for the early detection of colorectal cancer: A systematic review and meta-analysis of diagnostic test accuracy. BMJ Open Gastroenterol. 7, 355 (2020). 11. Trang Lan Vu, Trang Thu Nguyen, V. T. H. D. and L. T. T. V. Methylation Profiles of BRCA1, RASSF1A and GSTP1 in Vietnamese Women with Breast Cancer. (2018). 12. Phuong Kim Truong , Thuan Duc Lao, T. A. H. LE. Hypermethylation of DcR1 Gene-based Biomarker in Non-invasive Cancer Screening of Vietnamese
  55. Cervical Cancer Patients. (2018). 13. Thi Thuong Lan Vo , Bich Thuan Ta , Van To Ta , Dieu Linh Vuong, Q. U. N. Promoter Methylation Profile of GSTP1 and RASSF1A in Prostate Cancerand Benign Hyperplasia in Vietnamese Men. (2016). 14. Gilbert, C. and. Protocol for Extraction of hDNA from Formalin-fixed Museum Specimens: Liver Extraction by Phenol-chloroform. (2012). 15. Alexander, L. Rapid, Effective DNA Isolation from Osmanthus via Modified Alkaline Lysis. U.S. Dep. Agric. Agric. Res. Serv. U.S. Natl. Arboretum, Flor. Nurs. Plants Res. Unit, Otis L. Floyd Nurs. Res. Center, McMinnville, Tennessee, USA (2016). 16. Agnieszka K. Sarnecka, corresponding author1 Dominika Nawrat, 1 Monika Piwowar, 2 Janusz Ligęza, 3 Jakub Swadźba, 4 and Piotr Wójcik1. DNA extraction from FFPE tissue samples – a comparison of three procedures. (2019). 17. Unger, C., Lokmer, N., Lehmann, D. & Axmann, I. M. Detection of phenol contamination in RNA samples and its impact on qRT-PCR results. Anal. Biochem. 571, 49–52 (2019). Tài liệu khác 18. Global Cancer Observatory. 19. genes-that-correlate-with-human-prostate-cancer-224165. 20. Chromosome 17: 77,280,569-77,500,596 - Region in detail - Homo sapiens - Ensembl genome browser 100. 00184640;r=17:77280569-77500596. 21. EPD - SEPT9_7 viewer. bin/get_doc?db=hgEpdNew&format=genome&entry=SEPT9_7. 22. MethPrimer Results - MethPrimer - Li Lab, PUMCH.
  56. PHẦN PHỤ LỤC 1. Trình tự của các promoter khác của gene SEPT9 Bảng: Trình tự của 7 Promoter của gene SEPT9 Trình tự promoter trên gen SEPT9 Promoter ggcgggggcgcagcgcgcggggaggggccggcgcccgccttcctcccccattcattcagc 1 Promoter cggcccaggattagcgccctgggagcgcgcgccccgctgcctcgccgccaacactttcctg 2 Promoter ggccaggtcccccaggggctggagaggctggagaggcaggagctggatcagatctgaatc 3 Promoter gggtgacttctcagggttcctcctgggcaggtgctccggaaccttttctcagcacgctgg 4 Promoter gcccacatctggccgcagcggggcgcccggggggaggggctgaggccgcgtctctcgccg 5 Promoter ctgttttgatttcgcctcaataaaactctgacaccaccctccagtcataattagtcactt 6 Promoter cccgtaacaaccacaagtgccgtcgccgcgccccttccccctcccgcctccccggccccc 7 2. Các cặp mồi của promoter của gene SEPT9 2.1. Thiết kế trình tự mồi đặc hiệu methyl hoá cho Promoter 1 cuả gene SEPT9 3. Sequence Name: 4. Sequence Length: 1680 5. 6. CpG island prediction results 7. Criteria used: Island size > 100, GC Percent > 50.0, Obs/Exp > 0.60 8. 3 CpG island(s) were found in your sequence 9. Size (Start - End) 10. Island 1 158 bp (427 - 584) 11. Island 2 159 bp (617 - 775) 12. Island 3 785 bp (840 - 1624) 13. 14. Primer picking results for methylation specific PCR (MSP) 15.
  57. Primer Start Size Tm GC% 'C's Sequence 16. 1 Left M primer 1376 21 57.65 71.43 6 GATTTTGTTAGGGGTATTCGC 17. Right M primer 1562 25 56.27 48.00 5 ATTTCCCAAAATAAAACTATACGTC 18. Product size: 187, Tm: 69.4 19. Left U primer 1376 23 56.27 69.57 6 GATTTTGTTAGGGGTATTTGTGT 20. Right U primer 1562 25 54.28 48.00 5 ATTTCCCAAAATAAAACTATACATC 21. Product size: 187, Tm: 68.5 22. 2 Left M primer 1376 21 57.65 71.43 6 GATTTTGTTAGGGGTATTCGC 23. Right M primer 1562 25 56.27 48.00 5 ATTTCCCAAAATAAAACTATACGTC 24. Product size: 187, Tm: 69.4 25. Left U primer 1375 24 59.46 70.83 6 GGATTTTGTTAGGGGTATTTGTGT 26. Right U primer 1562 25 54.28 48.00 5 ATTTCCCAAAATAAAACTATACATC 27. Product size: 188, Tm: 68.5 28. 3 Left M primer 1376 21 57.65 71.43 6 GATTTTGTTAGGGGTATTCGC 29. Right M primer 1562 25 56.27 48.00 5 ATTTCCCAAAATAAAACTATACGTC 30. Product size: 187, Tm: 69.4 31. Left U primer 1375 24 59.46 70.83 6 GGATTTTGTTAGGGGTATTTGTGT 32. Right U primer 1561 24 53.79 50.00 5 TTTCCCAAAATAAAACTATACATC 33. Product size: 187, Tm: 68.5 34. 4 Left M primer 1376 21 57.65 71.43 6 GATTTTGTTAGGGGTATTCGC 35. Right M primer 1563 26 57.44 50.00 6 AATTTCCCAAAATAAAACTATACGTC 36. Product size: 188, Tm: 69.4 37. Left U primer 1376 23 56.27 69.57 6 GATTTTGTTAGGGGTATTTGTGT 38. Right U primer 1562 25 54.28 48.00 5 ATTTCCCAAAATAAAACTATACATC 39. Product size: 187, Tm: 68.5 40. 5 Left M primer 1294 23 59.42 65.22 6 GAGACGGGATTTTTAATTTAGGC 41. Right M primer 1433 25 59.75 68.00 9 ACGAACACAAAATCCTATAAAAACG 42. Product size: 140, Tm: 70.0 43. Left U primer 1293 24 58.02 66.67 6 GGAGATGGGATTTTTAATTTAGGT 44. Right U primer 1434 27 58.17 66.67 9 AACAAACACAAAATCCTATAAAAACAC 45. Product size: 142, Tm: 69.5 46. 47. 1 CAGCCCCTCGGCCCTGCCTGCCTTGTGGATGATATAGTTTAAGGGTAGAGACCGCTGGCC 48. :||::::|++|:::||::||::|||||||||||||||||||||||||||||:++:|||:: 49. 1 TAGTTTTTCGGTTTTGTTTGTTTTGTGGATGATATAGTTTAAGGGTAGAGATCGTTGGTT 50. 51.
  58. 52. 53. 61 TGGAGGGAAGGCTAGGCCTCAGGTTAGGGCCCAGAAGGGAGGGAGAAGCCCTTGGGGCAG 54. |||||||||||:||||::|:|||||||||:::||||||||||||||||:::||||||:|| 55. 61 TGGAGGGAAGGTTAGGTTTTAGGTTAGGGTTTAGAAGGGAGGGAGAAGTTTTTGGGGTAG 56. 57. 58. 59. 121 CTCCCTTTCTGCTCACTCACTGCCTAGCTCCTTCCTTCACACCTTCCTTCGGAAACGTCT 60. :|:::|||:||:|:|:|:|:||::|||:|::||::||:|:|::||::||++||||++|:| 61. 121 TTTTTTTTTTGTTTATTTATTGTTTAGTTTTTTTTTTTATATTTTTTTTCGGAAACGTTT 62. 63. 64. 65. 181 GCTCCTGACAAGGTCTACTTCCTGCTCTCAGGAGGCCCTTATTGTGGAGGAAGGGAGGCG 66. |:|::|||:|||||:||:||::||:|:|:||||||:::||||||||||||||||||||++ 67. 181 GTTTTTGATAAGGTTTATTTTTTGTTTTTAGGAGGTTTTTATTGTGGAGGAAGGGAGGCG 68. 69. 70. 71. 241 TCGCCCGTCCCTGGCTTCTCTGACAGCCGTGTTCCATCCCCGCCCTGTGCCCCTTCTCCC 72. |++::++|:::|||:||:|:|||:||:++||||::||:::++:::||||::::||:|::+ 73. 241 TCGTTCGTTTTTGGTTTTTTTGATAGTCGTGTTTTATTTTCGTTTTGTGTTTTTTTTTTC 74. 75. 76. 77. 301 GGACAGTGCCTTCTCCAGGGCTCACCCAGGAGGGTGCAGCGGTGGCCCCCGGGGCGGTGG 78. +||:||||::||:|::||||:|:|:::|||||||||:||++||||::::++|||++|||| 79. 301 GGATAGTGTTTTTTTTAGGGTTTATTTAGGAGGGTGTAGCGGTGGTTTTCGGGGCGGTGG 80. 81. 82. 83. 361 TCGTGGTGGGGGTGTTAGCTGCAGGGGTGCCCTCGGTGGGTGGGAGTTGGTGGCCTCTCG 84. |++|||||||||||||||:||:|||||||:::|++||||||||||||||||||::|:|++ 85. 361 TCGTGGTGGGGGTGTTAGTTGTAGGGGTGTTTTCGGTGGGTGGGAGTTGGTGGTTTTTCG 86. 87. 88. 89. 421 CTGGTGCCATGGGACTCGCATGTTCGCCCTGCGCCCCTCGGCTCTTGAGCCCACAGGCCG 90. :|||||::||||||:|++:|||||++:::||++::::|++|:|:|||||:::|:|||:++
  59. 91. 421 TTGGTGTTATGGGATTCGTATGTTCGTTTTGCGTTTTTCGGTTTTTGAGTTTATAGGTCG 92. 93. 94. 95. 481 GGATCCTGCCTGCCAGCCGCGTGCGCTGCCGTTTAACCCTTGCAGGCGCAGAGCGCGCGG 96. ||||::||::||::||:++++||++:||:++|||||:::|||:|||++:||||++++++| 97. 481 GGATTTTGTTTGTTAGTCGCGTGCGTTGTCGTTTAATTTTTGTAGGCGTAGAGCGCGCGG 98. 99. 100. 101. 541 CGGCGGTGACAGAGAACTTTGTTTGGCTGCCCAAATACAGCCTCCTGCAGAAGGACCCTG 102. ++|++||||:||||||:|||||||||:||:::|||||:||::|::||:|||||||:::|| 103. 541 CGGCGGTGATAGAGAATTTTGTTTGGTTGTTTAAATATAGTTTTTTGTAGAAGGATTTTG 104. 105. 106. 107. 601 CGCCCGGGGAAGGGGAGGAATCTCTTCCCCTCTGGGCGCCCGCCCTCCTCGCCATGGCCC 108. ++::++|||||||||||||||:|:||::::|:||||++::++:::|::|++::||||::+ 109. 601 CGTTCGGGGAAGGGGAGGAATTTTTTTTTTTTTGGGCGTTCGTTTTTTTCGTTATGGTTC 110. 111. 112. 113. 661 GGCCTCCACATCCGCCCACATCTGGCCGCAGCGGGGCGCCCGGGGGGAGGGGCTGAGGCC 114. +|::|::|:||:++:::|:||:|||:++:||++|||++::++||||||||||:|||||:+ 115. 661 GGTTTTTATATTCGTTTATATTTGGTCGTAGCGGGGCGTTCGGGGGGAGGGGTTGAGGTC 116. 117. 118. 119. 721 GCGTCTCTCGCCGTCCCCTGGGCGCGGGCCAGGCGGGGAGGAGGGGGGCGCTCCGGTCGT 120. +++|:|:|++:++|::::||||++++||::|||++|||||||||||||++:|:++||++| 121. 721 GCGTTTTTCGTCGTTTTTTGGGCGCGGGTTAGGCGGGGAGGAGGGGGGCGTTTCGGTCGT 122. 123. 124. 125. 781 GTGCCCAGGACTGTCCCCCAGCGGCCACTCGGGCCCCAGCCCCCCAGGCCTGGCCTTGAC 126. |||:::||||:|||:::::||++|::|:|++||::::||::::::|||::|||::||||: 127. 781 GTGTTTAGGATTGTTTTTTAGCGGTTATTCGGGTTTTAGTTTTTTAGGTTTGGTTTTGAT 128. 129. 130.
  60. 131. 841 AGGCGGGCGGAGCAGCCAGTGCGAGACAGGGAGGCCGGTGCGGGTGCGGGAACCTGATCC 132. |||++||++|||:||::||||++|||:|||||||:++|||++||||++||||::||||:+ 133. 841 AGGCGGGCGGAGTAGTTAGTGCGAGATAGGGAGGTCGGTGCGGGTGCGGGAATTTGATTC 134. 135. 136. 137. 901 GCCCGGGAGGCGGGGGCGGGGCGGGGGCGCAGCGCGCGGGGAGGGGCCGGCGCCCGCCTT 138. +::++|||||++||||++|||++||||++:||++++++||||||||:++|++::++::|| 139. 901 GTTCGGGAGGCGGGGGCGGGGCGGGGGCGTAGCGCGCGGGGAGGGGTCGGCGTTCGTTTT 140. 141. 142. 143. 961 CCTCCCCCATTCATTCAGCTGAGCCAGGGGGCCTAGGGGCTCCTCCGGCGGCTAGCTCTG 144. ::|:::::|||:|||:||:||||::||||||::||||||:|::|:++|++|:|||:|:|| 145. 961 TTTTTTTTATTTATTTAGTTGAGTTAGGGGGTTTAGGGGTTTTTTCGGCGGTTAGTTTTG 146. 147. 148. 149. 1021 CACTGCAGGAGCGCGGGCGCGGCGCCCCAGCCAGCGCGCAGGGCCCGGGCCCCGCCGGGG 150. :|:||:|||||++++||++++|++::::||::||++++:||||::++||:::++:++||| 151. 1021 TATTGTAGGAGCGCGGGCGCGGCGTTTTAGTTAGCGCGTAGGGTTCGGGTTTCGTCGGGG 152. 153. 154. 155. 1081 GCGCTTCCTCGCCGCTGCCCTCCGCGCGACCCGCTGCCCACCAGCCATCATGTCGGACCC 156. |++:||::|++:++:||:::|:++++++|::++:||:::|::||::||:||||++||::: 157. 1081 GCGTTTTTTCGTCGTTGTTTTTCGCGCGATTCGTTGTTTATTAGTTATTATGTCGGATTT 158. 159. 160. 161. 1141 CGCGGTCAACGCGCAGCTGGATGGGATCATTTCGGACTTCGAAGGTGGGTGCTGGGCTGG 162. ++++||:||++++:||:||||||||||:||||++||:||++||||||||||:||||:||| 163. 1141 CGCGGTTAACGCGTAGTTGGATGGGATTATTTCGGATTTCGAAGGTGGGTGTTGGGTTGG 164. 165. 166. 167. 1201 CTGCTGCGGCCGCGGACGTGCTGGAGAGGACCCTGCGGGTGGGCCTGGCGCGGGACGGGG 168. :||:||++|:++++||++||:|||||||||:::||++||||||::|||++++|||++||| 169. 1201 TTGTTGCGGTCGCGGACGTGTTGGAGAGGATTTTGCGGGTGGGTTTGGCGCGGGACGGGG
  61. 170. 171. 172. 173. 1261 GTGCGCTGAGGGGAGACGGGAGTGCGCTGAGGGGAGACGGGACCCCTAATCCAGGCGCCC 174. |||++:||||||||||++||||||++:||||||||||++|||::::||||::|||++::: 175. 1261 GTGCGTTGAGGGGAGACGGGAGTGCGTTGAGGGGAGACGGGATTTTTAATTTAGGCGTTT 176. 177. 178. 179. 1321 TCCCGCTGAGAGCGCCGCGCGCCCCCGGCCCCGTGCCCGCGCCGCCTACGTGGGGGACCC 180. |::++:||||||++:++++++::::++|:::++||::++++:++::||++|||||||::: 181. 1321 TTTCGTTGAGAGCGTCGCGCGTTTTCGGTTTCGTGTTCGCGTCGTTTACGTGGGGGATTT 182. M>>>>> 183. U>>>>> 184. 185. 1381 TGTTAGGGGCACCCGCGTAGACCCTGCGCGCCCTCACAGGACCCTGTGCTCGTTCTGCGC 186. |||||||||:|::++++||||:::||++++:::|:|:||||:::||||:|++||:||++: 187. 1381 TGTTAGGGGTATTCGCGTAGATTTTGCGCGTTTTTATAGGATTTTGTGTTCGTTTTGCGT 188. >>>>>>>>>>>>>>>> 189. >>>>>>>>>>>>>>>>>> 190. 191. 1441 ACTGCCGCCTGGGTTTCCTTCCTTTTATTGTTGTTTGTGTTTGCCAAGCGACAGCGACCT 192. |:||:++::|||||||::||::|||||||||||||||||||||::|||++|:||++|::| 193. 1441 ATTGTCGTTTGGGTTTTTTTTTTTTTATTGTTGTTTGTGTTTGTTAAGCGATAGCGATTT 194. 195. 196. 197. 1501 CCTCGAGGGCTCGCGAGGCTGCCTCGGAACTCTCCAGGACGCACAGTTTCACTCTGGGAA 198. ::|++||||:|++++|||:||::|++|||:|:|::||||++:|:|||||:|:|:|||||| 199. 1501 TTTCGAGGGTTCGCGAGGTTGTTTCGGAATTTTTTAGGACGTATAGTTTTATTTTGGGAA 200. M<<<<<<<<<<<<<<<<<<<<<<< 201. U<<<<<<<<<<<<<<<<<<<<<<< 202. 203. 1561 ATCCATCGGTCCCCTCCCTTTGGCTCTCCCCGGCGGCTCTCGGGCCCCGCTTGGACCCGG 204. ||::||++||::::|:::|||||:|:|:::++|++|:|:|++||:::++:|||||::++| 205. 1561 ATTTATCGGTTTTTTTTTTTTGGTTTTTTTCGGCGGTTTTCGGGTTTCGTTTGGATTCGG 206. << 207. <<
  62. 208. 209. 1621 CAACGGGATAGGGAGGTCGTTCCTCACCTCCGACTGAGTGGACAGCCGCGTCCTGCTCGG 210. :||++||||||||||||++||::|:|::|:++|:||||||||:||:++++|::||:|++| 211. 1621 TAACGGGATAGGGAGGTCGTTTTTTATTTTCGATTGAGTGGATAGTCGCGTTTTGTTCGG 212. 213. 214. 215. * 216. * Explanations * 217. * * 218. * Upper row: Original sequence * 219. * Lower row: Bisulfite modified sequence * 220. * (For display, assume all CpG sites are methylated) * 221. * ++ CpG sites * 222. * :::: Non-CpG 'C' converted to 'T' * 223. * M >>>>>> Left methylated-specific primer * 224. * M >>>>> Left unmethylated-specific primer * 227. * U <<<<<< Right unmethylated-specific primer * 228. * 229. 230. 3.5. Thiết kế trình tự mồi đặc hiệu methyl hoá cho promoter 2 của gene SEPT9
  63. Hình 1: Mô phỏng các cặp mồi khuếch đại trình tự promoter 2 của gene SEPT9 Trình tự các cặp mồi: Sequence Name: Sequence Length: 1378 CpG island prediction results Criteria used: Island size > 100, GC Percent > 50.0, Obs/Exp > 0.60 2 CpG island(s) were found in your sequence Size (Start - End) Island 1 960 bp (47 - 1006) Island 2 168 bp (1090 - 1257) Primer picking results for methylation specific PCR (MSP) Primer Start Size Tm GC% 'C's Sequence 1 Left M primer 566 20 54.85 65.00 8 TTTTTCGTTTTTTTATTCGG Right M primer 676 23 54.12 56.52 5 AACTTCTTCATAATACCTCCGTA Product size: 111, Tm: 73.3 Left U primer 564 22 53.49 63.64 9 TTTTTTTTGTTTTTTTATTTGG Right U primer 680 27 55.37 51.85 6 ATAAAACTTCTTCATAATACCTCCATA Product size: 117, Tm: 68.4 2 Left M primer 566 20 54.85 65.00 8 TTTTTCGTTTTTTTATTCGG Right M primer 677 24 55.53 54.17 5 AAACTTCTTCATAATACCTCCGTA Product size: 112, Tm: 73.6 Left U primer 564 22 53.49 63.64 9 TTTTTTTTGTTTTTTTATTTGG Right U primer 681 28 56.55 50.00 6 AATAAAACTTCTTCATAATACCTCCATA
  64. Product size: 118, Tm: 68.7 3 Left M primer 566 20 54.85 65.00 8 TTTTTCGTTTTTTTATTCGG Right M primer 675 22 52.56 54.55 4 ACTTCTTCATAATACCTCCGTA Product size: 110, Tm: 73.1 Left U primer 564 22 53.49 63.64 9 TTTTTTTTGTTTTTTTATTTGG Right U primer 679 26 54.95 50.00 5 TAAAACTTCTTCATAATACCTCCATA Product size: 116, Tm: 68.2 4 Left M primer 565 21 56.27 61.90 8 TTTTTTCGTTTTTTTATTCGG Right M primer 676 23 54.12 56.52 5 AACTTCTTCATAATACCTCCGTA Product size: 112, Tm: 73.6 Left U primer 564 22 53.49 63.64 9 TTTTTTTTGTTTTTTTATTTGG Right U primer 681 28 56.55 50.00 6 AATAAAACTTCTTCATAATACCTCCATA Product size: 118, Tm: 68.7 5 Left M primer 566 20 54.85 65.00 8 TTTTTCGTTTTTTTATTCGG Right M primer 676 23 54.12 56.52 5 AACTTCTTCATAATACCTCCGTA Product size: 111, Tm: 73.3 Left U primer 564 22 53.49 63.64 9 TTTTTTTTGTTTTTTTATTTGG Right U primer 681 28 56.55 50.00 6 AATAAAACTTCTTCATAATACCTCCATA Product size: 118, Tm: 68.7 1 GCAGGACAGGTGTCCTGTCCCGCCCTACCCCGGCCCACTAAGCCGGCACCCCGGCTCCGA |:||||:||||||::|||::++:::||:::++|:::|:||||:++|:|:::++|:|:++| 1 GTAGGATAGGTGTTTTGTTTCGTTTTATTTCGGTTTATTAAGTCGGTATTTCGGTTTCGA 61 CCCCCGGCTGTGCCCGGCGCCGCCGCGGTGCCCGGCGCCGCCGCCTCGCCCGGCGGGGCC ::::++|:||||::++|++:++:++++|||::++|++:++:++::|++::++|++|||:+ 61 TTTTCGGTTGTGTTCGGCGTCGTCGCGGTGTTCGGCGTCGTCGTTTCGTTCGGCGGGGTC 121 GCCCGGAGCGCCCGCACCTCCGCCCGCTTCCACCTGGCCGGGCCCGCCCCGCCCGGACTC +::++|||++::++:|::|:++::++:||::|::|||:++||::++:::++::++||:|+ 121 GTTCGGAGCGTTCGTATTTTCGTTCGTTTTTATTTGGTCGGGTTCGTTTCGTTCGGATTC 181 GGGACTGGGAAGTGCGGCGACTCCCGGAACCAGCCATTGGCGCCAGCGCGGGGAGCTGGG +|||:|||||||||++|++|:|::++|||::||::|||||++::||++++|||||:|||| 181 GGGATTGGGAAGTGCGGCGATTTTCGGAATTAGTTATTGGCGTTAGCGCGGGGAGTTGGG 241 GGTGCAGAGCTGCGGGCGCGGCGGGCCACGCAGGCGGCCCCCACCCCCGGCCTGGCCTGG ||||:||||:||++||++++|++||::|++:|||++|:::::|::::++|::|||::||| 241 GGTGTAGAGTTGCGGGCGCGGCGGGTTACGTAGGCGGTTTTTATTTTCGGTTTGGTTTGG 301 TCTGGTCTGGTCTGCGCTGCCGCGCGGGGGCGCCCCCTCCCAGGCCCGGCGCCCGCCAGC
  65. |:||||:||||:||++:||:++++++||||++:::::|:::|||::++|++::++::||: 301 TTTGGTTTGGTTTGCGTTGTCGCGCGGGGGCGTTTTTTTTTAGGTTCGGCGTTCGTTAGT 361 CCCGCTCCGCCAGGTGCAGCGCAGCGCAGGGGTGGGCGGGGGTGGGGCTCGGCGCGCACG ::++:|:++::|||||:||++:||++:|||||||||++|||||||||:|++|++++:|++ 361 TTCGTTTCGTTAGGTGTAGCGTAGCGTAGGGGTGGGCGGGGGTGGGGTTCGGCGCGTACG 421 TTCACGGGGCGGGGAGGGGGCGGGTCAGGGGCGGGACCACAGCCGGCTGGGCCGGGGTTC ||:|++|||++|||||||||++|||:|||||++|||::|:||:++|:||||:++|||||: 421 TTTACGGGGCGGGGAGGGGGCGGGTTAGGGGCGGGATTATAGTCGGTTGGGTCGGGGTTT 481 TATGCGCATCTCCGGGGAGGGGCGGGGCGGGGGCGGGGCCGGGGCGGGGCCCGGTCGGTG ||||++:||:|:++||||||||++|||++||||++|||:++|||++|||::++||++||| 481 TATGCGTATTTTCGGGGAGGGGCGGGGCGGGGGCGGGGTCGGGGCGGGGTTCGGTCGGTG 541 CACTCCAGACGGCGGGCCGCCCCCTCTTCCCGCCTTCCTACTCGGCCCAGGATTAGCGCC :|:|::|||++|++||:++:::::|:||::++::||::||:|++|:::||||||||++:: 541 TATTTTAGACGGCGGGTCGTTTTTTTTTTTCGTTTTTTTATTCGGTTTAGGATTAGCGTT M>>>>>>>>>>>>>>>>>>>> U>>>>>>>>>>>>>>>>>>>>>> 601 CTGGGAGCGCGCGCCCCGCTGCCTCGCCGCCACACTTTCCTGGGAGCGGCGGCCACGGAG :||||||++++++:::++:||::|++:++::|:|:|||::||||||++|++|::|++||| 601 TTGGGAGCGCGCGTTTCGTTGTTTCGTCGTTATATTTTTTTGGGAGCGGCGGTTACGGAG M<<<<<<< U<<<<<<< 661 GCACCATGAAGAAGTCTTACTCAGGTGGGCTTCGCGCCCGGGGTGGGGAGGGGTCGGTGT |:|::||||||||||:|||:|:|||||||:||++++::++||||||||||||||++|||| 661 GTATTATGAAGAAGTTTTATTTAGGTGGGTTTCGCGTTCGGGGTGGGGAGGGGTCGGTGT <<<<<<<<<<<<<<<< <<<<<<<<<<<<<<<<<<<< 721 CCCGGGACCAGCGCTGCTCACCTGAGTGCCTGCGGCCGGGAGTGGCGAGGCGCCCCCGGA ::++|||::||++:||:|:|::||||||::||++|:++|||||||++|||++::::++|| 721 TTCGGGATTAGCGTTGTTTATTTGAGTGTTTGCGGTCGGGAGTGGCGAGGCGTTTTCGGA 781 GCTGAGCGAGTCCCCGCGGCGGGCACACTGCAGGTCGAGTTCCTCCCAGGACAGGGCCGC |:||||++|||:::++++|++||:|:|:||:||||++||||::|:::||||:||||:++: 781 GTTGAGCGAGTTTTCGCGGCGGGTATATTGTAGGTCGAGTTTTTTTTAGGATAGGGTCGT 841 TGTCGGGCCGCTTTCGACCTGAGCCGACCGTCCCCTGCGCTGTCTCCAGCCCTTGCTCGA |||++||:++:|||++|::||||:++|:++|::::||++:|||:|::||:::|||:|++| 841 TGTCGGGTCGTTTTCGATTTGAGTCGATCGTTTTTTGCGTTGTTTTTAGTTTTTGTTCGA 901 GTGTCGGAGGGGCTGCCCTGGGGGACGCTCCCTCTTCCTCGCCCCTTGCACCCTCGCAGG
  66. ||||++||||||:||:::|||||||++:|:::|:||::|++::::|||:|:::|++:||| 901 GTGTCGGAGGGGTTGTTTTGGGGGACGTTTTTTTTTTTTCGTTTTTTGTATTTTCGTAGG 961 AATCGCTGACTTTCCAGGTCGGCCGGGTGCTTTGGGTCCCTGTGCGTCTGTGTGGGTGAA |||++:|||:|||::||||++|:++||||:|||||||:::||||++|:|||||||||||| 961 AATCGTTGATTTTTTAGGTCGGTCGGGTGTTTTGGGTTTTTGTGCGTTTGTGTGGGTGAA 1021 TGGGGTCGGGGCTAGGTGGAGGGGTGTCCTTGGGTTCAGCCTCTAGGGCTGGTGGTCCAG ||||||++|||:|||||||||||||||::|||||||:||::|:|||||:|||||||::|| 1021 TGGGGTCGGGGTTAGGTGGAGGGGTGTTTTTGGGTTTAGTTTTTAGGGTTGGTGGTTTAG 1081 GCCGCAGCATCCTTTCTTCGGATTCTCTTCGGTTTCTCCTCTACTTAGTGGGGCACGGGA |:++:||:||::|||:||++||||:|:||++||||:|::|:||:|||||||||:|++||| 1081 GTCGTAGTATTTTTTTTTCGGATTTTTTTCGGTTTTTTTTTTATTTAGTGGGGTACGGGA 1141 CGGCCTCCAGATGGGACCGTCCAGCAGCGCCCAAACTTGGCGACTCGGGTTCACGTTTTG ++|::|::||||||||:++|::||:||++:::|||:||||++|:|++||||:|++||||| 1141 CGGTTTTTAGATGGGATCGTTTAGTAGCGTTTAAATTTGGCGATTCGGGTTTACGTTTTG 1201 CGCTCAGGACGCCGCCCGCGGCTGACATCCTCACTCCACCCTAGCAGGGCCCGCCTTAAG ++:|:||||++:++::++++|:|||:||::|:|:|::|:::|||:||||::++::||||| 1201 CGTTTAGGACGTCGTTCGCGGTTGATATTTTTATTTTATTTTAGTAGGGTTCGTTTTAAG 1261 TAGGCGAAGGGGGCCTGACTTGGGCCTCACCATGAGCCGGTTCAGGAGCTTTCATTTCAT ||||++|||||||::|||:|||||::|:|::|||||:++|||:|||||:|||:||||:|| 1261 TAGGCGAAGGGGGTTTGATTTGGGTTTTATTATGAGTCGGTTTAGGAGTTTTTATTTTAT 1321 AAGAGGCTCCCGCTCTGGCACTCTGAAGTTCCATTTCACAGATGGGCACACCGAGGCC ||||||:|::++:|:|||:|:|:|||||||::||||:|:|||||||:|:|:++|||:: 1321 AAGAGGTTTTCGTTTTGGTATTTTGAAGTTTTATTTTATAGATGGGTATATCGAGGTT * Explanations * * * * Upper row: Original sequence * * Lower row: Bisulfite modified sequence * * (For display, assume all CpG sites are methylated) * * ++ CpG sites * * :::: Non-CpG 'C' converted to 'T' * * M >>>>>> Left methylated-specific primer * * M >>>>> Left unmethylated-specific primer * * U <<<<<< Right unmethylated-specific primer *
  67. MethPrimer v1.1 beta Li Lab, PUMCH 3.6. Thiết kế trình tự mồi đặc hiệu methyl hoá cho promoter 3 của gene SEPT9 Hình 2: Mô phỏng các cặp mồi đặc hiệu methyl hoá cho promoter 3 của gene SEPT9 Ở promoter 3 của gene SEPT9 không có sự trùng lặp với đảo CpG, vì vậy tôi không thiết kế mồi cho promoter 3 của gene SEPT9. 3.7. Thiết kế mồi đặc hiệu methyl hoá cho trình tự promoter 4 của gene SEPT9
  68. Hình 3: Mô phỏng các cặp mồi đặc hiệu methyl hoá cho promoter 4 của gene SEPT9 Trình tự các cặp mồi: Sequence Name: Sequence Length: 1260 CpG island prediction results Criteria used: Island size > 100, GC Percent > 50.0, Obs/Exp > 0.60 1 CpG island(s) were found in your sequence Size (Start - End) Island 1 150 bp (832 - 981) Primer picking results for methylation specific PCR (MSP) Primer Start Size Tm GC% 'C's Sequence 1 Left M primer 821 25 55.92 48.00 4 ATTAAAAAGGAGTAGTAAGTTTCGG Right M primer 1074 25 55.65 44.00 5 AATAACATTATCTCTTCAAAACGAA Product size: 254, Tm: 67.4 Left U primer 821 25 54.00 48.00 4 ATTAAAAAGGAGTAGTAAGTTTTGG Right U primer 1080 30 57.80 40.00 5 AACTAAAATAACATTATCTCTTCAAAACAA Product size: 260, Tm: 66.7 2 Left M primer 828 21 58.79 71.43 4 AGGAGTAGTAAGTTTCGGGGC Right M primer 1074 25 55.65 44.00 5 AATAACATTATCTCTTCAAAACGAA Product size: 247, Tm: 67.1
  69. Left U primer 824 25 59.04 60.00 4 AAAAAGGAGTAGTAAGTTTTGGGGT Right U primer 1075 26 54.98 42.31 5 AAATAACATTATCTCTTCAAAACAAA Product size: 252, Tm: 66.6 3 Left M primer 828 21 58.79 71.43 4 AGGAGTAGTAAGTTTCGGGGC Right M primer 1074 25 55.65 44.00 5 AATAACATTATCTCTTCAAAACGAA Product size: 247, Tm: 67.1 Left U primer 824 25 59.04 60.00 4 AAAAAGGAGTAGTAAGTTTTGGGGT Right U primer 1074 25 53.63 44.00 5 AATAACATTATCTCTTCAAAACAAA Product size: 251, Tm: 66.5 4 Left M primer 822 24 55.51 50.00 4 TTAAAAAGGAGTAGTAAGTTTCGG Right M primer 1074 25 55.65 44.00 5 AATAACATTATCTCTTCAAAACGAA Product size: 253, Tm: 67.4 Left U primer 821 25 54.00 48.00 4 ATTAAAAAGGAGTAGTAAGTTTTGG Right U primer 1080 30 57.80 40.00 5 AACTAAAATAACATTATCTCTTCAAAACAA Product size: 260, Tm: 66.7 5 Left M primer 820 26 56.05 46.15 4 TATTAAAAAGGAGTAGTAAGTTTCGG Right M primer 1074 25 55.65 44.00 5 AATAACATTATCTCTTCAAAACGAA Product size: 255, Tm: 67.4 Left U primer 821 25 54.00 48.00 4 ATTAAAAAGGAGTAGTAAGTTTTGG Right U primer 1080 30 57.80 40.00 5 AACTAAAATAACATTATCTCTTCAAAACAA Product size: 260, Tm: 66.7 1 CCACGCGTCCTCCCTTTCTCAACAGAAGCTGACAGTCTGGAGTTTTCAGAGAGATTGCCT ::|++++|::|:::|||:|:||:|||||:|||:|||:|||||||||:||||||||||::| 1 TTACGCGTTTTTTTTTTTTTAATAGAAGTTGATAGTTTGGAGTTTTTAGAGAGATTGTTT 61 GAGTTCTCAGCCTTGGCACAAACACACATTCTCTTTAAACAGGCTTGGGCCAACAGAACC |||||:|:||::||||:|:|||:|:|:|||:|:||||||:|||:|||||::||:||||:: 61 GAGTTTTTAGTTTTGGTATAAATATATATTTTTTTTAAATAGGTTTGGGTTAATAGAATT 121 AGCCTCCGTGTCTCGGGTTTGAATGAACCCTTGAGGTGAAGCTTAAAGACAGAGAGGATG ||::|:++|||:|++||||||||||||:::|||||||||||:|||||||:|||||||||| 121 AGTTTTCGTGTTTCGGGTTTGAATGAATTTTTGAGGTGAAGTTTAAAGATAGAGAGGATG 181 CCCCTGATTCCCACCCCAGGGACCCACATTGTAAACCCCCACCTGCTCTGCTGAGCCCTT ::::|||||:::|::::|||||:::|:||||||||:::::|::||:|:||:||||:::|| 181 TTTTTGATTTTTATTTTAGGGATTTATATTGTAAATTTTTATTTGTTTTGTTGAGTTTTT 241 GGCCTCAGCATGGACCCTGACCATGTGCTGGTGGGGACCCCCCAGGTAAGTAAGCAGCCT ||::|:||:|||||:::|||::|||||:|||||||||::::::|||||||||||:||::| 241 GGTTTTAGTATGGATTTTGATTATGTGTTGGTGGGGATTTTTTAGGTAAGTAAGTAGTTT
  70. 301 CTGAGGACCCCGGATGAACAGTGGGGAACAGCACTGATCCCCCAGTGGGGCCCCGAGTTC :||||||:::++||||||:|||||||||:||:|:||||:::::|||||||:::++||||: 301 TTGAGGATTTCGGATGAATAGTGGGGAATAGTATTGATTTTTTAGTGGGGTTTCGAGTTT 361 CCGGAGAGGAAGACTCGCTCCCTCCCAGGGGACGGCTAGAGACTCACTGACTCATGCGTG :++||||||||||:|++:|:::|:::||||||++|:||||||:|:|:|||:|:|||++|| 361 TCGGAGAGGAAGATTCGTTTTTTTTTAGGGGACGGTTAGAGATTTATTGATTTATGCGTG 421 TGTGGTAGGAATCTTCCAGGAAGTCCCCGTCCCGTTCGCCCTCTCTGCCTGGGCGGGGAC ||||||||||||:||::|||||||:::++|::++||++:::|:|:||::||||++||||+ 421 TGTGGTAGGAATTTTTTAGGAAGTTTTCGTTTCGTTCGTTTTTTTTGTTTGGGCGGGGAC 481 GGCAACTGCCTCTGTCACTGCAGACTAATGGGACGGAGGGGGGTGACTTCTCAGGGTTCC +|:||:||::|:|||:|:||:|||:||||||||++|||||||||||:||:|:||||||:: 481 GGTAATTGTTTTTGTTATTGTAGATTAATGGGACGGAGGGGGGTGATTTTTTAGGGTTTT 541 TCCTGGGCAGGTGCTCCGGAACCTTTTCTCAGCACGCTGGCCTGGGGCACGGCCGTTCCT |::||||:|||||:|:++|||::||||:|:||:|++:|||::|||||:|++|:++||::| 541 TTTTGGGTAGGTGTTTCGGAATTTTTTTTTAGTACGTTGGTTTGGGGTACGGTCGTTTTT 601 CCTGCCCAGCCACGTTGGGGTACAGGGTGAAGAAGGGCTGGGGCCAGCCCAGGACAGAGG ::||:::||::|++||||||||:||||||||||||||:|||||::||:::||||:||||| 601 TTTGTTTAGTTACGTTGGGGTATAGGGTGAAGAAGGGTTGGGGTTAGTTTAGGATAGAGG 661 AAGGCGAGGCAGGCACGCAGGAACTGGGCTTTTTAAACCCTTAAGCCCAAGGAAATCGTA ||||++|||:|||:|++:|||||:||||:||||||||:::|||||:::||||||||++|| 661 AAGGCGAGGTAGGTACGTAGGAATTGGGTTTTTTAAATTTTTAAGTTTAAGGAAATCGTA 721 GCATCGCGGGACAGGGAAAATGAAAGACTTTGGAAGTCGTCAGGAATTTGACTCTGTGAG |:||++++|||:|||||||||||||||:|||||||||++|:||||||||||:|:|||||| 721 GTATCGCGGGATAGGGAAAATGAAAGATTTTGGAAGTCGTTAGGAATTTGATTTTGTGAG 781 TTGGTTTCCAAGAGTCTAAGTTAAGCATCTCCAAGTGGATATTAAAAAGGAGCAGCAAGC |||||||::||||||:|||||||||:||:|::||||||||||||||||||||:||:|||: 781 TTGGTTTTTAAGAGTTTAAGTTAAGTATTTTTAAGTGGATATTAAAAAGGAGTAGTAAGT M>>>>>>>>>>>>>>>>>>>> U>>>>>>>>>>>>>>>>>>>> 841 CTCGGGGCGGCGGGGGCTGGAGGAGGTGGAGAGAGGAGGCTGCCGGAAGCCGCACTCGGG :|++|||++|++||||:||||||||||||||||||||||:||:++||||:++:|:|++|| 841 TTCGGGGCGGCGGGGGTTGGAGGAGGTGGAGAGAGGAGGTTGTCGGAAGTCGTATTCGGG >>>>> >>>>>
  71. 901 ACCTCTGCAGCCACCGACCAGACCGGGCGGCCGGGACTCTGGGACTCTCGCAGGCAGACC |::|:||:||::|:++|::|||:++||++|:++|||:|:|||||:|:|++:|||:|||:: 901 ATTTTTGTAGTTATCGATTAGATCGGGCGGTCGGGATTTTGGGATTTTCGTAGGTAGATT 961 CGGTGGTCTGCCGGACTCCTCGGGGCCCACTTCGGGCCCTCTCTCCTGCCTCCTATTTTT ++|||||:||:++||:|::|++|||:::|:||++||:::|:|:|::||::|::||||||| 961 CGGTGGTTTGTCGGATTTTTCGGGGTTTATTTCGGGTTTTTTTTTTTGTTTTTTATTTTT 1021 GGATTTCTCTCCTTTGCTCCCTTTTTCCTCCCGTTTTGAAGAGACAATGCTACTTCAGTT ||||||:|:|::||||:|:::|||||::|::++|||||||||||:||||:||:||:|||| 1021 GGATTTTTTTTTTTTGTTTTTTTTTTTTTTTCGTTTTGAAGAGATAATGTTATTTTAGTT M >>>>> Left methylated-specific primer * * M >>>>> Left unmethylated-specific primer * * U <<<<<< Right unmethylated-specific primer * MethPrimer v1.1 beta Li Lab, PUMCH 3.8. Thiết kế mồi đặc hiệu methyl hoá cho trình tự promoter 5 của gene SEPT9
  72. Hình 4: Mô phỏng các cặp mồi đặc hiệu methyl hoá cho promoter 5 của gene SEPT9 Trình tự mồi: Sequence Name: Sequence Length: 1320 CpG island prediction results Criteria used: Island size > 100, GC Percent > 50.0, Obs/Exp > 0.60 3 CpG island(s) were found in your sequence Size (Start - End) Island 1 158 bp (307 - 464) Island 2 159 bp (497 - 655) Island 3 546 bp (720 - 1265) Primer picking results for methylation specific PCR (MSP) Primer Start Size Tm GC% 'C's Sequence 1 Left M primer 735 22 59.26 72.73 4 GTTAGTGCGAGATAGGGAGGTC Right M primer 912 24 58.41 66.67 6 GCTCCTACAATACAAAACTAACCG Product size: 178, Tm: 66.7 Left U primer 734 24 57.93 70.83 4 AGTTAGTGTGAGATAGGGAGGTTG Right U primer 913 26 57.50 69.23 6 CACTCCTACAATACAAAACTAACCAC Product size: 180, Tm: 65.0 2 Left M primer 736 21 58.42 71.43 4 TTAGTGCGAGATAGGGAGGTC
  73. Right M primer 912 24 58.41 66.67 6 GCTCCTACAATACAAAACTAACCG Product size: 177, Tm: 66.7 Left U primer 734 24 57.93 70.83 4 AGTTAGTGTGAGATAGGGAGGTTG Right U primer 913 26 57.50 69.23 6 CACTCCTACAATACAAAACTAACCAC Product size: 180, Tm: 65.0 3 Left M primer 735 22 59.26 72.73 4 GTTAGTGCGAGATAGGGAGGTC Right M primer 908 23 59.96 69.57 6 CTACAATACAAAACTAACCGCCG Product size: 174, Tm: 66.8 Left U primer 733 25 58.01 72.00 5 TAGTTAGTGTGAGATAGGGAGGTTG Right U primer 910 25 58.95 68.00 6 TCCTACAATACAAAACTAACCACCA Product size: 178, Tm: 65.1 4 Left M primer 999 25 57.90 68.00 9 TATTAGTTATTATGTCGGATTTCGC Right M primer 1196 21 56.90 66.67 6 GCCTAAATTAAAAATCCCGTC Product size: 198, Tm: 67.2 Left U primer 1000 26 56.90 69.23 8 ATTAGTTATTATGTTGGATTTTGTGG Right U primer 1200 25 58.02 72.00 9 AAACACCTAAATTAAAAATCCCATC Product size: 201, Tm: 65.9 5 Left M primer 735 22 59.26 72.73 4 GTTAGTGCGAGATAGGGAGGTC Right M primer 908 23 59.96 69.57 6 CTACAATACAAAACTAACCGCCG Product size: 174, Tm: 66.8 Left U primer 733 25 58.01 72.00 5 TAGTTAGTGTGAGATAGGGAGGTTG Right U primer 908 25 56.67 68.00 7 CTACAATACAAAACTAACCACCAAA Product size: 176, Tm: 65.1 1 CTCCCTTTCTGCTCACTCACTGCCTAGCTCCTTCCTTCACACCTTCCTTCGGAAACGTCT :|:::|||:||:|:|:|:|:||::|||:|::||::||:|:|::||::||++||||++|:| 1 TTTTTTTTTTGTTTATTTATTGTTTAGTTTTTTTTTTTATATTTTTTTTCGGAAACGTTT 61 GCTCCTGACAAGGTCTACTTCCTGCTCTCAGGAGGCCCTTATTGTGGAGGAAGGGAGGCG |:|::|||:|||||:||:||::||:|:|:||||||:::||||||||||||||||||||++ 61 GTTTTTGATAAGGTTTATTTTTTGTTTTTAGGAGGTTTTTATTGTGGAGGAAGGGAGGCG 121 TCGCCCGTCCCTGGCTTCTCTGACAGCCGTGTTCCATCCCCGCCCTGTGCCCCTTCTCCC |++::++|:::|||:||:|:|||:||:++||||::||:::++:::||||::::||:|::+ 121 TCGTTCGTTTTTGGTTTTTTTGATAGTCGTGTTTTATTTTCGTTTTGTGTTTTTTTTTTC 181 GGACAGTGCCTTCTCCAGGGCTCACCCAGGAGGGTGCAGCGGTGGCCCCCGGGGCGGTGG +||:||||::||:|::||||:|:|:::|||||||||:||++||||::::++|||++|||| 181 GGATAGTGTTTTTTTTAGGGTTTATTTAGGAGGGTGTAGCGGTGGTTTTCGGGGCGGTGG 241 TCGTGGTGGGGGTGTTAGCTGCAGGGGTGCCCTCGGTGGGTGGGAGTTGGTGGCCTCTCG |++|||||||||||||||:||:|||||||:::|++||||||||||||||||||::|:|++