Đồ án Xác định cộng đồng vi sinh bằng phương pháp PCR và DGGE từ rơm trước và sau khi xử lý trồng nấm rơm

pdf 102 trang thiennha21 12/04/2022 100
Bạn đang xem 20 trang mẫu của tài liệu "Đồ án Xác định cộng đồng vi sinh bằng phương pháp PCR và DGGE từ rơm trước và sau khi xử lý trồng nấm rơm", để tải tài liệu gốc về máy bạn click vào nút DOWNLOAD ở trên

Tài liệu đính kèm:

  • pdfdo_an_xac_dinh_cong_dong_vi_sinh_bang_phuong_phap_pcr_va_dgg.pdf

Nội dung text: Đồ án Xác định cộng đồng vi sinh bằng phương pháp PCR và DGGE từ rơm trước và sau khi xử lý trồng nấm rơm

  1. BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC KỸ THUẬT CÔNG NGHỆ TP. HCM ĐỒ ÁN TỐT NGHIỆP XÁC ĐỊNH CỘNG ĐỒNG VI SINH BẰNG PHƯƠNG PHÁP PCR VÀ DGGE TỪ RƠM TRƯỚC VÀ SAU KHI XỬ LÝ TRỒNG NẤM RƠM Ngành: CÔNG NGHỆ SINH HỌC Chuyên ngành: CÔNG NGHỆ SINH HỌC Giảng viên hướng dẫn : TS. HOÀNG QUỐC KHÁNH CN. NGÔ ĐỨC DUY Sinh viên thực hiện : HOÀNG NGỌC PHƯƠNG THẢO MSSV: 0851110222 Lớp: 08DSH4 TP. Hồ Chí Minh, 2012
  2. Đồ án tốt nghiệp LỜI MỞ ĐẦU 1. Tính cấp thiết của đề tài Nghiên cứu về cộng đồng vi sinh vật trong các môi trường sống nhằm tìm hiểu thêm đa dạng sinh học là một trong những mong muốn của các nhà khoa học trên thế giới. Trước đây, để phân tích cộng đồng vi sinh vật trong các môi trường tự nhiên, các nhà khoa học phải nuôi cấy và phân lập qua nhiều công đoạn khác nhau, tốn thời gian và công sức nhưng lại không đem đến kết quả mong muốn. Trong số tất cả các vi sinh vật trong tự nhiên, khoảng 99% không được phát hiện bằng kỹ thuật nuôi cấy. Vì vậy, sinh học phân tử, phương pháp nhận biết độc lập, khuếch đại và giải trình tự gen 16S rDNA, thường được sử dụng để có một dữ liệu đầy đủ hơn về một cộng đồng sống trong một môi trường cụ thể, sinh học phân tử ra đời đã khắc phục những khó khăn vẫn còn hạn chế của công nghệ sinh học, nhằm góp phần xác định cộng đồng của vi sinh vật trong môi trường nhanh chóng mà không phải qua nhiều giai đoạn nuôi cấy và phân lập, qua đó giúp các nhà khoa học hiểu biết nhiều hơn về đa dạng sinh học, từ đó đưa vào các ứng dụng nhằm phục vụ cho thực tiễn. Áp dụng sinh học phân tử để nghiên cứu cộng đồng vi sinh có trong rơm rạ ở giai đoạn trước và sau khi xử lý trong trồng nấm là rất cần thiết. Định danh hệ vi sinh vật có trong mẫu rơm bằng việc ly trích và thu nhận DNA trực tiếp, so sánh sự thay đổi hệ vi sinh trong mẫu rơm ở các giai đoạn tiền xử lý trước khi đưa vào trồng nấm, từ đó có thể bổ sung hệ vi sinh phù hợp vào giai đoạn rơm tiền xử lý nhằm rút ngắn thời gian ủ rơm trước khi đưa vào trồng nấm, đem lại hiệu quả kinh tế cao hơn cho người dân. Đây cũng là bước khởi đầu quan trọng cho chúng ta có thêm kiến thức về sự đa dạng sinh học trong nguồn cơ chất này, góp phần ứng dụng cho các nghiên cứu tiếp theo. 1
  3. Đồ án tốt nghiệp 2. Tình hình nghiên cứu Ly trích DNA của vi sinh vật trực tiếp từ rơm rạ để tìm hiểu cộng đồng vi sinh vật đã được thực hiện tại một số phòng thí nghiệm về nông nghiệp các nước. Tuy có những quy trình ly trích DNA khác nhau nhưng đều chung mục đích là thu nhận DNA của nhóm vi khuẩn phục vụ cho các nghiên cứu tiếp theo. Ở Việt Nam, mặc dù rơm rạ là một nguồn năng lượng lớn nhưng vẫn chưa được ứng dụng nhiều so với vai trò mà nó có thể mang lại. Rơm rạ nói riêng và từ biomass nói chung không được sử dụng một cách hiệu quả. Phần lớn chúng được đốt và bỏ trở lại ruộng sau khi thu hoạch, sử dụng làm chất đốt cho các hộ nhà nông, làm cơ chất trồng nấm, làm thức ăn cho gia súc gây lãng phí một nguồn năng lượng tiềm năng. Việc ly trích và thu nhận trức tiếp DNA của nhóm vi khuẩn từ rơm vẫn chưa được nghiên cứu và ứng dụng nhiều, chủ yếu là phân lập và ly trích từ những chủng thuần vi sinh cho những mục đích nghiên cứu khác nhau. 3. Mục đích nghiên cứu - Ly trích và thu nhận DNA vi khuẩn trực tiếp từ rơm trước và sau khi xử lý trong trồng nấm. - Xác định nhóm vi khuẩn trong rơm trước và sau khi xử lý trong trồng nấm bằng phương pháp PCR và DGGE, giải mã trình tự đoạn gene vùng V3 của đoạn 16S rDNA. - Thành lập cây phân loài của nhóm vi khuẩn có trong rơm trước và sau xử lý. 4. Nhiệm vụ nghiên cứu - Ly trích và thu nhận DNA tổng số vi sinh trực tiếp từ rơm xử lý trong trồng nấm. - Tiến hành tinh sạch và kiểm tra độ tinh sạch DNA của nhóm vi khuẩn. - Sử dụng phương pháp khuếch đại đoạn gene 16S rDNA của vi khuẩn. Điện di và kiểm tra sản phẩm PCR trên gel agarose. - Xác định nhóm vi khuẩn trong rơm bằng phương pháp DGGE vùng V3 thuôc đoạn gene 16S rDNA. - Giải mã trình tự đoạn gene vùng V3 của đoạn 16S rDNA. 2
  4. Đồ án tốt nghiệp - Hình thành cây phân loài của hệ vi khuẩn có trong rơm trước và sau khi xử lý. 5. Phương pháp nghiên cứu - Hình thức thu mẫu: Thu mẫu rơm trước và sau khi xử lý trong trồng nấm. - Ly trích và thu nhận DNA tổng số vi sinh bằng phương pháp SDS. - Tinh sạch DNA bằng bộ kit: GFX PCR DNA and Gel Band Purification Kit. - Xác định nhóm vi khuẩn bằng phương pháp PCR khuếch đại đoạn gene 16S rDNA dựa vào cặp mồi 27F 5’ – GA GTT TGA TCM TGG CTC AG – 3’ và 1492R 5’ – TAC GGG TAC CTT GTT CG ACT T – 3’, sau đó tinh sạch sản phẩm PCR trước khi phân tích DGGE. - Phương pháp DGGE được sử dụng để xác định hệ vi khuẩn trong mẫu: + PCR vùng V3 thuộc đoạn gene 16S rDNA của vi khuẩn được thực hiện với cặp mồi chuyên biệt cho nhóm vi khuẩn là 517R 5’ – ATT AC GCG GCT GCT CC – 3’ và 357F – GC 5’ – CGC CCG CGC GCG GGC GGG GGG GGG GCA CGG GGG CCT ACG GGA GGC AGC AG – 3’. + Thực hiện phương pháp DGGE trên gel polyacrylamide. + PCR vùng V3 của đoạn gene 16S rDNA sau khi DGGE với cặp mồi 357F 5’ – CCT ACG GGA GGC AGC AG – 3’ và 517R 5’ – ATT ACC GCG GCT GCT GG – 3’. Tinh sạch và thu nhận DNA từ gel polyacrylamide bằng bộ Kit QIAEX II trước khi bước vào giải trình tự loài. + Giải trình tự đoạn gene vùng V3 thuộc đoạn 16S rDNA của vi khuẩn. + Kết quả giải trình tự được so chuỗi bằng chương trình BLAST trên ngân hàng dữ liệu gene của NCBI. 6. Kết quả nghiên cứu - Ly trích và thu nhận DNA vi khuẩn trực tiếp từ rơm trước và sau xử lý trong trồng nấm rơm. - Xác định nhóm vi khuẩn cần nghiên cứu dựa vào sự khuếch đại đoạn gene 16S rDNA bằng phản ứng PCR. - Xác định nhóm vi khuẩn trong mẫu bằng phương pháp DGGE của vùng V3 thuộc đoạn gene 16S rDNA. 3
  5. Đồ án tốt nghiệp - Giải mã được trình tự đoạn gene vùng V3 thuộc đoạn 16S rDNA của vi khuẩn. - Hình thành cây phân loài của cộng đồng vi khuẩn có trong rơm trước và sau xử lý 7. Kết cấu của đồ án tốt nghiệp Đồ án tốt nghiệp gồm 4 chương: - Chương 1: Tổng quan - Chương 2: Vật liệu và phương pháp - Chương 3: Kết quả và thảo luận - Chương 4: Kết luận và kiến nghị 4
  6. Đồ án tốt nghiệp CHƯƠNG 1: TỔNG QUAN 1.1 Tổng quan về rơm rạ 1.1.1 Thành phần cấu tạo của rơm rạ Cây lúa luôn giữ vị trí trung tâm trong nông nghiệp và kinh tế Việt Nam. Hình ảnh đất Việt thường được mô tả như là một chiếc đòn gánh khổng lồ với hai đầu là hai vựa thóc lớn là Đồng Bằng Sông Cửu Long (ĐBSCL) và Đồng Bằng Sông Hồng (ĐBSH). Khoảng 80% trong số 11 triệu hộ nông dân tham gia sản xuất lúa gạo, chủ yếu dựa vào hình thức canh tác thủ công truyền thống. [8] Việc sản xuất lúa gạo đã tạo ra một lượng lớn phế phẩm từ cây lúa bao gồm rơm và trấu. Rơm và trấu là hai trong số nhiều nguồn biomass phổ biến và có tiềm năng ở Việt Nam. Rơm rạ là thành phần hỗn hợp của nhiều hợp chất hóa học khác nhau tạo nên trong một thành phần cấu trúc cao phân tử gồm cacbonhydrate, một lượng nhỏ protein và khoáng. Nghiên cứu tế bào qua kính hiển vi có thể cho thấy mô hình cấu tạo phức tạp của rơm. Các phần phân đoạn chính của thực vật nói chung và rơm rạ nói riêng gồm: các đốt (mắt), lóng (thân) và lá. Tỷ lệ cấu trúc phân đoạn của các loài tương đối khác nhau do nhiều yếu tố: Loài, vụ mùa, đất, điều kiện khí hậu Như một hệ quả, khi thành phần hóa học các phần phân đoạn của thực vật khác nhau thì cấu tạo của mỗi loài cũng khác nhau. [17] Thành phần hóa học của rơm rạ tính theo khối lượng khô gồm cellulose 60 %, lignin 14%, đạm hữu cơ (protein) 3,4%, chất béo (lipid) 1,9%. Nếu tính theo nguyên tố thì cacbon (C) chiếm 44%, hydro (H) 5%, oxygen (O) 49%, N khoảng 0,92% , một lượng rất nhỏ photpho (P), lưu huỳnh (S) và kali (K). 5
  7. Đồ án tốt nghiệp Bảng 1.1: Thành phần cấu tạo hóa học ở các phần phân đoạn của rơm ở 2 dạng lúa: lúa ngắn ngày và lúa dài ngày (Antongiovanni và cộng sự, 1991). [17] Lúa dài ngày Lúa ngắn ngày Thành phần Lóng Đốt (mắt) Lá Lóng Đốt (mắt) Lá cấu tạo g/kg DM Nitơ tổng 34 70 38 26 39 35 Thành tế bào 782 737 787 766 773 800 Tro 100 162 211 184 182 193 Silica 28 26 103 29 55 67 Cellulose 411 327 323 433 332 364 Hemicellulose 245 286 256 242 331 283 Rơm rạ có hai đặc tính cơ bản là: Hàm lượng N thấp (< 1%), nghèo khoáng và vitamin, chứa nhiều xơ thô nên tỷ lệ tiêu hóa thấp. Việc tiêu hóa xơ nhờ hoạt động lên men của vi sinh vật trong đường tiêu hóa. Chất xơ trong rơm chủ yếu là cellulose, hemicelluloses và lignin. Giữa chúng có các liên kết hóa học tạo nên sự bền vững của màng tế bào thực vật. Cellulose gồm nhiều chuỗi thẳng ghép nhau thành bó dài nhờ mạch nối hydrogen tạo thành các micell bền vững. Cellulose có cấu tạo dạng sợi, có cấu trúc phân tử là một polymer mạch thẳng, mỗi đơn vị là một disaccharide gọi là cellobiose, có cấu trúc từ hai phân tử D – glucose. Cấu trúc bậc 2 và bậc 3 rất phức tạp thành cấu trúc dạng lớp gắn với nhau bằng lực liên kết hydro. [2] Lực liên kết hydro trùng hợp nhiều lần nên rất bền vững, một phân tử cellulose gồm từ 7000 – 14000 đơn vị glucose tạo thành. Hemicellulose là những heteropolysaccharide cùng với cellulose có ở màng tế bào thực vật. Hemicellulose không hòa tan được trong nước nhưng hòa tan được trong dung dịch kiềm và bị 6
  8. Đồ án tốt nghiệp thủy phân bởi acid dễ dàng hơn so với cellulose. Khi bị thủy phân, từ hemicelluloses sẽ tạo ra glucose, fructose, mantose, galactose, cuabinose và xylose. Thành phần thứ ba đáng chú ý trong xơ là lignin. Lignin luôn đi kèm với cellulose và hemicellulose trong thành phần tế bào, không hòa tan trong nước, trong các dung môi hữu cơ bình thường và rất bền vững bởi enzyme của hệ sinh vật dạ cỏ. Nhưng dưới tác dụng của kiềm thì lignin một phần bị phân giải và chuyển vào dung dịch. Trong dạ cỏ loài nhai lại có những vi khuẩn đặc biệt chứa enzyme cellulase phân giải được cellulose. Cellulose và hemicellulose là những hợp chất có thể tiêu hóa được. Nhưng phần lớn cellulose tham gia cấu tạo trong của vách tế bào rơm nên enzyme của hệ vi sinh vật không dễ dàng tác động được. Lớp ngoài thành tế bào được tạo thành chủ yếu từ các phức chất lignohemicellulose mà các enzyme vi sinh dạ cỏ phân giải vô cùng chậm. Điều đó cản trở những lớp trong giàu cellulose trước tác động của enzyme vi sinh vật, cũng như cản trở sự phân giải chất chứa tế bào. Để nâng cao tỷ lệ tiêu hóa của rơm rạ và các chất xơ khác, các nhà nghiên cứu đã tiến hành xử lý rơm bằng nhiều phương pháp như: lý học, hóa học, vi sinh vật học [1] 1.1.2 Cộng đồng vi sinh vật phân giải cellulose Rơm rạ có từ 400 - 430 g xơ trong 1 kg chất khô khó phân hủy. Về nguyên tắc rơm rạ có thể được hệ vi sinh dạ cỏ phân giải, tuy nhiên do bị lignin hóa cao nên khả năng tiêu hóa thực tế bị hạn chế. Sự liên kết chặt chẽ giữa lignin với cacbonhydrate tạo thành các phức hợp lingo – hemicellulose/cellulose ở vách tế bào thực vật. Liên kết này có lợi cho thực vật nhưng lại bất lợi cho quá trình lên men của vi sinh vật, làm cản trở tác động của enzyme vi sinh vật. Các biện pháp xử lý nhằm làm thay đổi một số tính chất hóa lý của rơm để làm tăng khả năng phân giải của vi sinh vật với thành phần xơ. Cellulose là thành phần chủ yếu của vách tế bào thực vật. Hàng ngày, hàng giờ, một lượng lớn cellulose được tích lũy lại trong đất do các sản phẩm tổng hợp của thực vật thải ra, cây cối chết đi, cành lá rụng xuống. Một phần không nhỏ do con người thải ra dưới dạng rác thải, giấy vụn, phôi bào, mùn cưa Nếu không có 7
  9. Đồ án tốt nghiệp quá trình phân giải của sinh vật thì lượng chất hữu cơ khổng lồ này sẽ tràn ngập trái đất. Cellulose rất khó phân giải, bởi vậy vi sinh vật phân hủy cellulose phải có một hệ enzyme gọi là cellulase bao gồm 4 enzyme khác nhau. Enzyme C1 có tác dụng cắt đứt liên kết hydro, biến dạng cellulose tự nhiên có cấu hình không gian thành dạng cellulose vô định hình, enzyme này gọi là cellobiohydrolase. Enzyme thứ hai là endoglucanase có khả năng cắt đứt các liên kết β-1, 4 bên trong phân tử tạo thành những chuỗi dài. Enzyme thứ 3 là exo – gluconase tiến hành phân giải các chuỗi trên thành Disaccharide gọi là Cellobiose. Cả hai loại enzyme endo và exo – gluconase được gọi là Cx. Enzyme thứ 4 là β – glucosidase tiến hành thủy phân cellobiose thành glucose. [2] Β - glucosidase C1 CX Cellulose tự nhiên cellulose vô định hình cellobiose glucose Trong thiên nhiên có nhiều nhóm vi sinh vật có khả năng phân hủy cellulose nhờ có hệ cellulase ngoại bào. Cellulase được tổng hợp từ nhiều chủng vi sinh khác nhau: + Cellulase từ vi khuẩn: Bacillus megaterium, Pseudomonas fluorenscens, Acetobacter Xylium, vi khuẩn dạ cỏ, Clostridium + Cellulase từ xạ khuẩn: Các loài Actinomyces, Streptomyces + Cellulase từ nấm: Aspergylus niger, Aspergylus Oryzae, Tricoderma, Mucor pusillus. [22] Trong đó vi nấm là nhóm có khả năng phân giải mạnh vì nó tiết ra môi trường một lượng lớn enzyme đầy đủ các thành phần. Các nấm mốc có hoạt tính phân giải cellulose đáng chú ý là Tricoderma. Hầu hết các loài thuộc chi Tricoderma sống hoại sinh trong đất và đều có khả năng phân hủy cellulose. Chúng tiến hành phân hủy các tàn dư của thực vật để lại trong đất, góp phần chuyển hóa một lượng chất hữu cơ khổng lồ. Tricoderma còn sống trên tre, nứa, gỗ tạo thành lớp mốc màu xanh phá hủy các vật liệu trên. Trong nhóm vi nấm, ngoài 8
  10. Đồ án tốt nghiệp Tricoderma còn có nhiều giống khác có khả năng phân giải cellulose như Aspergillus, Fusarium, Mucor Nhiều loài vi khuẩn cũng có khả năng phân hủy cellulose. Thường ở trong đất có ít loài vi khuẩn có khả năng tiết ra đầy đủ 4 loại enzyme, trong hệ enzyme cellulase. Nhóm này tiết ra một loại enzyme trong hệ enzyme cellulase. Nhóm này tiết ra một loại enzyme này, nhóm khác tiết ra loại khác, chúng phối hợp với nhau để phân giải cơ chất trong mối quan hệ hỗ sinh. Nhóm vi khuẩn hiếu khí gồm Pseudomonas, Cellulomonase, Achromobacter. Nhóm vi khuẩn kỵ khí bao gồm Clostridium và đặc biệt là nhóm vi khuẩn sống trong dạ cỏ của động vật nhai lại. Chính nhờ nhóm vi khuẩn này mà trâu bò có thể sử dụng cellulose có trong cỏ, rơm rạ làm thức ăn. Đó là những cầu khuẩn thuộc chi Rumonococcus có khả năng phân hủy cellulose thành đường và các acid hữu cơ. Ngoài vi nấm và vi khuẩn, xạ khuẩn và niêm vi khuẩn cũng có khả năng phân hủy cellulose. Người ta thường sử dụng xạ khuẩn, đặc biệt là chi Streptomyces trong việc phân hủy rác thải sinh hoạt. Những xạ khuẩn này thường thuộc nhóm ưa nóng, sinh trưởng, phát triển tốt nhất ở nhiệt độ 45 – 50 0C rất thích hợp với quá trình ủ rác thải. [2] Nhìn chung, hệ vi sinh vật trong rơm rạ rất đa dạng về cả mặt phân loại và chức năng. Tổng cộng có 259 chủng vi khuẩn và 45 loài nấm đã được phân lập với các đặc tính chức năng khác nhau. Sự đa dạng cộng đồng vi sinh vật trong rơm rạ được đánh giá bằng việc giải trình tự 16S rDNA đã cho kết luận rằng có 17 họ vi khuẩn và 9 họ nấm có trong rơm. Bacillaceace, Burkholderiaceae, Enterobacteraceae và Pseudomonadaceae là các họ phổ biến nhất. Hoạt động phân giải cellulose được phát hiện ở Bacilliaceae, Enterobacteriaceae, Flexibateraceae, Microbacteriaceae và Paenibacillaceae. Hoạt tính phân giải chitin phổ biến ở các loài Flexibacterceae, Burkholderiaceae, Enterobacteriaceae, Oxalobacteriaceae, Staphylococcaeae và Xanthomonadaceae. Các tác nhân gây bệnh ở lúa tiềm năng là 9
  11. Đồ án tốt nghiệp họ Nectriaceae và Trichocomaceae được phát hiện từ việc phân lập rơm. Các loài nấm và vi khuẩn đóng góp đáng kể vào sự phân hủy rơm rạ. [8] Hệ vi sinh vật phân giải cellulose có thể lên men kỵ khí hoặc hiếu khí, bình nhiệt hoặc ái nhiệt, bao gồm nấm, vi khuẩn, xạ khuẩn được tìm thấy nhiều trong đất, nước, đường tiêu hóa của một số động vật nơi cung cấp lượng cellulose dồi dào để vi sinh vật phân giải và phát triển. 1.2 Các phương pháp ly trích và thu nhận DNA tổng số 1.2.1 Nguyên tắc và yêu cầu Ly trích và thu nhận DNA tổng số là nhu cầu cần thiết bởi các thực nghiệm của công nghệ gene đều tiến hành với DNA (hay RNA). DNA cần phải đảm bảo về độ tinh khiết và độ nguyên vẹn về cấu trúc để có thể thực hiện được các khâu nghiên cứu tiếp theo. Có rất nhiều phương pháp ly trích và thu nhận DNA tổng số, tùy thuộc vào mục đích nghiên cứu mà lựa chọn các phương pháp ly trích và thu nhận DNA tổng số cho phù hợp. DNA là phân tử có kích thước lớn, do đó trong thao tác cần tránh mọi tác nhân cơ học hay hóa học quá mạnh có thể làm đứt hay gãy phân tử này. [20] 1.2.2 Một số phương pháp ly trích và thu nhận DNA tổng số Mọi nghiên cứu và ứng dụng trong sinh học phân tử đều phải bắt nguồn từ DNA. Do đó cần phải tách chiết được một lượng DNA đủ lớn và tinh sạch. Để ức chế hoạt động của enzyme nội bào thì các phân tử DNA phải được tách chiết trong điều kiện nhiệt độ thấp. Một số phương pháp ly trích và thu nhận DNA tổng số: 1.2.2.1 Phương pháp ly trích và thu nhận DNA tổng số vi sinh vật trong môi trường tự nhiên Vi sinh vật trong tự nhiên rất đa dạng, mức độ đa dạng của vi sinh vật thay đổi theo từng môi trường. Những vi sinh vật tìm thấy thường là những tế bào đơn hoặc là những tập đoàn vi sinh vật. Sự phức tạp tính di truyền của cộng đồng vi sinh vật được đánh giá thông qua việc xác định bởi sự tổ hợp DNA, chưa kể sự có mặt của những bộ gene hiếm và những vi sinh vật chưa được khám phá. [15] 10
  12. Đồ án tốt nghiệp Sự ra đời kỹ thuật dựa trên phân tử acid nucleic đã dẫn tới sự thay đổi lớn trong việc phát hiện vi sinh vật trong môi trường tự nhiên (Liesack và cộng sự, 1992; Ward và cộng sự, 1990). Với những kỹ thuật này đã phát hiện một số thay đổi lớn về việc tìm hiểu cấu trúc và sự vận động của các vi sinh vật cộng đồng trong môi trường tự nhiên (Lionet và cộng sự, 2003). Mặc dù các phương pháp trong kỹ thuật dựa trên phân tử acid nucleic này đã phá vỡ những hạn chế trong việc chọn lọc và tính chất đặc trưng trong việc ly trích DNA (Head và cộng sự, 1998). Sự phục hồi tính đa dạng của vi khuẩn chịu ảnh hưởng của việc ly trích DNA, độ tinh khiết của DNA từ môi trường có đạt yêu cầu hay không? Sự hiện diện của các thành phần khác trong môi trường sẽ làm ảnh hưởng và cản trở sự phát hiện DNA thể hiện qua kết quả ly trích và tinh sạch. Vì vậy việc lựa chọn các phương pháp ly trích và tinh sạch là rất quan trọng cho DNA của vi sinh vật từ môi trường tự nhiên. [10] Ly trích DNA thường bị ảnh hưởng bởi các yếu tố như không ly trích hoàn toàn tế bào vi khuẩn hoặc DNA bị hư hỏng (Miller và cộng sự, 1999). Rõ ràng việc áp dụng một quy trình ly trích DNA phù hợp với các mẫu cụ thể là rất cần thiết cho việc đánh giá đúng đa dạng vi sinh vật. Phương pháp ly trích DNA cần phải đơn giản, nhanh chóng và hiệu quả. Chất lượng DNA là rất quan trọng ảnh hưởng đến hiệu quả khuếch đại DNA về sau. Do đó ly trích DNA được coi như một bước phân tích độc lập trong phân tích đa dạng vi sinh vật (Abriouel và cộng sự, 2006; Cankar và cộng sự, 2006). Việc ly trích thường kết hợp với các chất tẩy, các tác nhân vật lý, các dung môi và enzyme để thu được nucleic acid (Sokollek và cộng sự, 1998; Nanda và cộng sự, 2001; Gonzaslez và cộng sự, 2004; Gullo và cộng sự, 2006; Haruta và cộng sự, 2006; Ndoye và cộng sự, 2006). [6] Những phương pháp ly trích DNA tổng số vi sinh vật từ môi trường tự nhiên thường được sử dụng:  Phương pháp Sodium Dodecyl Sulfate (SDS): Đây được xem là phương pháp thích hợp nhất, đơn giản và nhanh chóng thu nhận DNA của vi sinh vật với hiệu quả cao, phục vụ cho quá trình PCR tiếp theo. J Zhou và cộng sự (1996) 11
  13. Đồ án tốt nghiệp đã sử dụng phương pháp ly trích với nồng độ muối cao (1,5 M NaCl) và ủ mẫu trong 2 – 3 giờ trong sự hiện diện của Sodium dodecyl sulfate (SDS), hexadecyltrimethylammonium bromide, và proteinase K. [9]  Phương pháp Cetyl – Trimetyl – Ammoniumbromide (CTAB) ly trích DNA: Đây là phương pháp dùng trong chiết xuất acid nucleic có hiệu quả cao, CTAB là một dung môi có khả năng hòa tan cao acid nucleic, vì vậy mà CTAB được dùng với vai trò là chất chính trong tách chiết acid nucleic. Ly trích DNA của vi khuẩn sử dụng phương pháp CTAB được mô tả bởi Ausubel và cộng sự (1992). Ly trích DNA cần phải có cả hai yếu tố là hiệu suất và độ tinh khiết. Phương pháp ly trích DNA cho hiệu suất cao thường chứa các tạp chất ảnh hưởng đến quá trình thí nghiệm về sau, còn phương pháp cho độ tinh khiết cao lại tỷ lệ nghịch với hiệu suất (Zimmermann và cộng sự, 1998). Trong nghiên cứu của Jara C. (2008), phương pháp ly trích tốt nhất là phương pháp CTAB. [6]  Phương pháp Benzyl chloride: Đây là phương pháp ly trích DNA tương đối hiệu quả. Nó có thể phá vỡ thành tế bào vi khuẩn kết hợp với việc gia nhiệt đến 650 C. Ưu điểm của phương pháp này là đơn giản, nhanh chóng và mang lại kết quả khá cao. Phương pháp này được Zhu và cộng sự (1993) sử dụng để ly trích DNA của cả thực vật, nấm và vi khuẩn. [21]  Phương pháp đóng băng và tan băng: Đây là phương pháp do Ellingsue và cộng sự (2002). Phương pháp này sử dụng kỹ thuật đóng băng và tan băng ở - 650C trong ba chu kỳ nhằm ức chế phá vỡ vách tế bào, giải phóng các thành phần bên trong tế bào, tạo điều kiện thuận lợi cho việc ly trích DNA tổng số vi sinh vật từ môi trường tự nhiên. [9] Một sự so sánh và kết hợp về các phương pháp ly trích DNA trực tiếp từ cộng đồng vi sinh vật được Juria R. (2004) báo cáo. Lựa chọn và ứng dụng một quy trình vào thử nghiệm ly trích DNA rất quan trọng. Có hai hướng chính: (1) là ly trích từ tế bào vi sinh đã được phân lập và (2) là ly trích trực tiếp từ mẫu ban đầu mà không qua phân lập chủng vi sinh (Saano và cộng sự, 1995). Trong cả hai 12
  14. Đồ án tốt nghiệp hướng trên, một số phương pháp khác nhau được sử dụng trong ly trích DNA gồm các chu kỳ đóng băng và tan băng, đun sôi, dùng nitơ lỏng, nghiền nhỏ, thẩm thấu, SDS, Lysozyme và một số cách khác (Sorensen và cộng sự, 2002). Ở đây, sử dụng phương pháp ly trích DNA trực tiếp từ đất theo Ogram và cộng sự (1987) và có sửa đổi để phù hợp hơn. [11] 1.2.2.2 Phương pháp ly trích và thu nhận DNA vi khuẩn trực tiếp từ rơm rạ Để thu nhận DNA vi khuẩn đảm bảo về độ tinh sạch thì cần loại bỏ hết những thành phần tạp nhiễm, trong đó quan trọng nhất là protein. Sự ly trích DNA dựa trên nguyên tắc hòa tan khác nhau của các phân tử khác nhau trong hai pha không hòa tan (phenol, chloroform/nước). Mục đích cuối cùng vẫn là thu nhận được DNA ở trạng thái còn nguyên vẹn tối đa, không bị phân hủy bởi các tác nhân cơ học hay hóa học. Việc thu nhận DNA cần được tách chiết trong điều kiện nhiệt độ thấp để ức chế hoạt động của các enzyme nội bào. Sau công đoạn tách chiết, DNA sẽ được tinh sạch. Sự tủa kết hợp với ly tâm cho phép thu nhận DNA dưới dạng cặn tủa dể bảo quản và khi cần có thể hòa tan trong nước khử ion hoặc trong dung dịch TE theo nồng độ mong muốn.  Một số phương pháp ly trích DNA vi khuẩn từ rơm rạ: Rơm rạ là thành phần chính trong sản xuất methanol, một khí gây hiệu ứng nhà kính, rơm là nguồn phế phẩm của ngành nông nghiệp. Cộng đồng vi sinh phân giải rơm rạ trong điều kiện hiếu khí đang được các nhà khoa học nghiên cứu bằng phương pháp sinh học phân tử. Việc ủ rơm và phân tích ở các giai đoạn khác nhau sẽ cho ra các kết quả về cộng đồng vi sinh khác nhau qua PCR và điện di mẫu (Sabine Weber và cộng sự, 2011). [19] Ngoài ra, cộng đồng vi sinh cũng có sự đa dạng khác nhau trên các nguồn rơm rạ ở các pH khác nhau. Cộng đồng vi sinh trong rơm dưới những điều kiện pH khác nhau đã được kiểm tra bằng cách sử dụng phương pháp in – vitro với một số sửa đổi của Sung và cộng sự (2006). DNA vi khuẩn được ly trích từ rơm theo phương pháp được mô tả bởi Purdy và cộng sự (1996). [12] 13
  15. Đồ án tốt nghiệp Các mẫu lá và thân rơm sử dụng 0,5 g trọng lượng tươi để phân tích DNA tổng số vi khuẩn. Việc ly trích được thực hiện theo phương pháp tan băng theo Zhou và cộng sự (1996), Tun và cộng sự (2002). [5] Một nghiên cứu khác về ly trích DNA của vi sinh vật phân giải cellulose bằng phương pháp Benzyl Chloride (Zhu và cộng sự, 1993), sau đó để loại bỏ thành phần tạp có trong mẫu chiết xuất bằng cách sử dụng Geneclean spin kit (BIO101, Carlsbad, Calif.) ở giai đoạn tinh sạch. [18] 1.2.2.3 Phương pháp ly trích và thu nhận DNA vi khuẩn từ dịch khuẩn nuôi cấy Để ly trích DNA vi khuẩn từ dịch khuẩn nuôi cấy, Ghazanfar và cộng sự (2010) đã sử dụng quy trình của Roger S. và cộng sự (1994) quy trình cải tiến CTAB. Sau khi ly trích, DNA tổng số được điện di trên gel agarose 1% ở điện thế 100 Volts trong 5 phút và đo Nanodrop để xác định nồng độ và độ tinh sạch. Phương pháp này sử dụng CTAB nóng, đây là một dung môi có khả năng hòa tan cao acid nucleic. Ở nhiệt độ cao, CTAB còn có tác dụng làm rách thêm màng tế bào và màng nhân để giải phóng tối đa lượng acid nucleic ra dung dịch làm biến tính một số protein, đặc biệt là enzyme thủy phân acid nucleic. Giúp cho việc ly trích DNA đạt hiệu quả tốt nhất. [15] 1.3 Phương pháp PCR và ứng dụng 1.3.1 Phương pháp PCR Phương pháp PCR do Karl Mullis và cộng sự phát minh vào năm 1985, là một cuộc cách mạng trong sinh học phân tử. PCR là phương pháp dùng enzyme khuếch đại chọn lọc một đoạn ADN theo luật số mũ. Phản ứng nhân gene được thực hiện với enzyme ADN chịu nhiệt, hai mồi tổng hợp và 4 loại deoxyribonucleic (dATP, dGTP, dCTP và dTTP). Mỗi một chu kỳ phản ứng nhân gene gồm 3 bước: Bước 1 là biến tính ADN, có tác dụng tách hai sợi đơn từ sợi khuôn xoắn kép. Bước 2 là bắt cặp hai mồi vào hai sợi đơn của khuôn. Bước 3 là kéo dài chuỗi theo mồi, chiều 5’-3’ với quá trình trùng hợp gắn các dNTP dọc theo sợi khuôn để tạo thành phiên bản mới theo nguyên tắc bổ 14
  16. Đồ án tốt nghiệp sung. Tính đặc hiệu của phản ứng được quy định bởi mồi và sự sao chép trực tiếp theo trình tự sợi khuôn giữa hai mồi. Như vậy, kết quả tạo ra hàng triệu phiên bản sợi khuôn trong vài giờ. Mồi cho phản ứng là các đoạn DNA có kích thước 20 – 30 nucleotice được thiết kế theo trình tự của đoạn gene cần khuếch đại dựa theo dữ liệu có sẵn. Mỗi cặp mồi phải hoàn thành chức năng của mình trong toàn bộ phản ứng, tức là chúng phải bám đặc hiệu vào đúng vị trí riêng cho từng mồi. Sở dĩ như vậy là do nếu chúng không bám vào vị trí đặc hiệu thì không thể khuếch đại được đoạn gene đích. Với các gene như rDNA thì khi cặp mồi được thiết kế thì chúng có thể nhân được gene từ nhiều đối tượng. Ngược lại, trong nhiều trường hợp dùng mồi không đặc hiệu thì có thể nhân được các sản phẩm PCR không đặc hiệu. Tuy nhiên, cả hai kết quả trên đều được dùng cho xác định loại vi sinh vật. Thí nghiệm phản ứng PCR lần đầu tiên dùng mảnh Klenow của enzym DNA polymerase I từ E.coli. Tuy nhiên, enzyme này bị biến tính tại 94 oC và như vậy cần phải bổ sung enzyme mới sau mỗi chu kỳ phản ứng. Đến nay quá trình này đã được cải thiện do dùng enzyme Taq DNA polymerase (Taq = Thermus aquaticus) chịu nhiệt. Enzyme này được tách ra từ vi khuẩn sống ở suối nước nóng. Tốc độ xúc tác cho phản ứng của enzyme này rất nhanh, có thể đạt khoảng 8000 bp/phút tại 755 oC. Hoạt tính enzyme giảm một nửa khi xử lý tại 92,5 oC trong 230 phút hoặc 40 phút tại 95 oC. Như vậy khi dùng enzyme này thì không cần bổ sung enzyme mới sau mỗi chu kỳ phản ứng. Phản ứng PCR sử dụng enzyme chịu nhiệt tạo ra nhiều phiên bản theo hàm số mũ. Một sợi DNA ban đầu sau vài giờ có thể nhân lên 1011 phiên bản DNA. Sau khi thực hiện phản ứng PCR cần tiến hành một số kỹ thuật để xác định sản phẩm như điện di và xác định kích thước sản phẩm PCR. Phương pháp PCR nhanh chóng được chú ý và trở nên phổ biến trong nghiên cứu phát hiện vi khuẩn hay virus ở nồng độ thấp trong các mẫu môi trường và bệnh phẩm. Một số ứng dụng kỹ thuật PCR phát hiện các đối tượng vi sinh vật khác nhau được trình bày trong tạp chí 15
  17. Đồ án tốt nghiệp chuyên ngành như Journal of Clinical Microbiology, Applied Environmental Microbiology. [23] 1.3.2 Ứng dụng phương pháp PCR trong quá trình xác định loài vi sinh vật Kỹ thuật PCR đã được sử dụng rộng rãi trong các nghiên cứu xác định DNA nhiều đối tượng vi sinh vật. Nguồn DNA đích đôi khi chỉ có số lượng ít trừ khi tiến hành nuôi cấy vi sinh vật. Trong một số trường hợp việc nuôi cấy không thể thực hiện được với nhiều loài vi sinh vật hoặc virus hoặc trong trường hợp khác là cần thời gian nuôi cấy vi sinh vật để có đủ DNA cho việc lai hoặc xác định loài. PCR ra đời đã khắc phục được những khó khăn này. Từ khi có sự ra đời của kỹ thuật PCR thì kỹ thuật giải trình tự cũng có những tiến bộ vượt bậc. Chỉ cần dùng PCR là có thể nhân bản đoạn gen muốn giải trình tự thành hàng tỷ bản sao hoàn toàn giống hệt nhau và sản phẩm khuếch đại này có thể đưa vào giải trình tự trực tiếp mà không cần phải chèn một plasmid giải trình tự nữa. Sự phát minh ra kỹ thuật nhân bản DNA trong ống nghiệm bằng PCR cũng giúp cho việc cải tiến phản ứng giải trình tự kém hiệu quả trước đây trở nên hiệu quả hơn nhờ áp dụng enzyme polymerase giải trình tự bền với nhiệt độ để phản ứng giải trình tự được thực hiện qua các chu kỳ giống hệt PCR, mà ngày nay chúng ta gọi là phản ứng chu kỳ nhiệt giải trình tự. Với phản ứng chu kỳ nhiệt giải trình tự thì hiệu quả phản ứng tốt hơn rất nhiều, đồng thời tối ưu hóa các thành phần của phản ứng cũng dễ dàng hơn rất nhiều. Có thể nói chính sự ra đời và hoàn thiện kỹ thuật PCR đã giúp tăng tốc giải trình tự không những trong vấn đề hoàn thiện nó mà cả trong vấn đề phạm vi áp dụng. [25] Tiến hành PCR khuếch đại những đoạn gene đặc trưng của các loài vi sinh vật nghiên cứu dựa trên những cặp mồi đặc trưng của từng loài vi sinh vật. Mỗi vi sinh vật đều có những cặp mồi chuyên biệt để có thể dựa vào đó chúng ta có thể dễ dàng xác định được chúng. Sử dụng phương pháp PCR để xác định giống Lactobacillus được thực hiện thông qua việc sử dụng cặp mồi chuyên biệt cho giống Lactobacillus gồm: Lac 1 và Lac 2, trình tự các cặp mồi này như sau: 16
  18. Đồ án tốt nghiệp Lac 1 5’ – AGC AGT AGG GAA TCT TCC A – 3’ Lac 2 5’ – ATT CCA CCG CTA CAC ATG – 3’ Phản ứng khuếch đại đoạn gene 16S rDNA được thực hiện với hai mồi chuyên biệt cho giống Lactobacillus gồm Lac 3 và Lac 4, trình tự các mồi như sau: Lac 3 5’ – GGA AAC AGA TGC TAA TAC CG – 3’ Lac 4 5’ – CAC CGC TAC ACA TGG AG – 3’ Sử dụng phản ứng PCR khuếch đại đoạn gene D1/D2 26S rDNA và đoạn gene ITS 5,8S rDNA đặc trưng cho nấm men. [4] Các cặp mồi được sử dụng khuếch đại đoạn gene D1/D2 26S rDNA, ITS 5,8S rDNA đặc trưng cho nấm men. Trình tự cặp mồi NL và ITS: Cặp NL: NL4 5’ – GCA TAT CAA TAA GCG GAG GAA AAG – 3’ NL4 5’ – GGT CCG TGT TTC AAG ACG G – 3’ Cặp ITS: ITS1 5’ – TCC GTA GGT GAA CCT GCG G – 3’ ITS4 5’ – TCC TCC GCT TAT TGA TAT GC – 3’ Bảng 1.2: Một số vi sinh vật được nghiên cứu bằng phương pháp PCR. [23] Vi sinh vật Tài liệu Clostridium difficile Gumerlock et al (1991) Escherichia coli Jackson (1992) Helicobacter pylori Claton et al (1992) Litsteria monocytogenees Niederhauser et al (1992) Mycobacterium tuberculosis Altamirano et al (1992) Salmonella spp Rahn et al (1992) Staphylococcus spp Murakami et al (1991) Yersinia Nakajima et al (1992) 17
  19. Đồ án tốt nghiệp 1.3.3 Ứng dụng phương pháp PCR trong quá trình xác định loài vi khuẩn Phương pháp PCR là một phương pháp được ứng dụng rộng rãi trong việc xác định loài vi sinh vật. Đối với các loài vi khuẩn cũng vậy, người ta sử dụng phương pháp PCR để khuếch đại những đoạn gene của vi khuẩn. Kết quả thu được từ những phản ứng PCR là thu nhận những đoạn gene với kích thước như mong muốn. Mỗi loài vi khuẩn đều có những cặp mồi chuyên biệt, dựa trên những cặp mồi chuyên biệt này kết hợp với những yếu tố cần thiết trong phản ứng PCR thì việc xác định loài vi khuẩn trở nên đơn giản hơn. Ví dụ mồi cho vi khuẩn Haemophilus influenza (gene bexA): Hib 1: GCG AAA GTG ACC TCT TAT CTC TC Hib 2: GCT TAC GCT TCT ATC TCG GTG AA Các vi khuẩn khó nuôi cấy thường có mặt ngoài môi trường tự nhiên có thể xác định trực tiếp bằng PCR, ví dụ như các Legionella, Samonella, Shigella và Vibrio cholera. Chỉ cần từ 10 – 1000 tế bào vi khuẩn tùy theo kỹ thuật là đủ để thực hiện phản ứng PCR. Nhờ khuếch đại những đoạn gene 16S rDNA đặc trưng của vi khuẩn với những cặp mồi chuyên biệt, người ta có thể so sánh mối quan hệ gần hay xa giữa các vi khuẩn, góp phần phân loại vi khuẩn chi tiết và chính xác hơn. [24] 1.4 Ứng dụng DGGE trong xác định cộng đồng vi sinh 1.4.1. Phương pháp DGGE Điện di gel gradient biến tính (DGGE) là một phương pháp hữu hiệu để xác định đột biến và đa dạng vi sinh vật. DGGE có hai yếu tố cơ bản như sau: (1) Sự biến tính DNA bằng nhiệt độ đặc biệt thay đối với trình tự nucleotide và sự cặp đôi; (2) Sự biến tính từng phần của sợi kép DNA làm chậm lại quá trình di chuyển của nó trong gel polyacrylamide. [3] DGGE là một kỹ thuật được sử dụng trong sinh học phân tử và trở thành một phương pháp chính yếu để xác định đặc tính về mật độ kết cấu và động học. Đây là một phương pháp mới, có thể cung cấp nhanh chóng đặc tính, xác định sự đa dạng và thành phần cấu trúc hệ vi sinh vật. DGGE còn ứng dụng trong lĩnh vực 18
  20. Đồ án tốt nghiệp y học để phát hiện các đột biến, gồm các đoạn đơn nucleotide đa hình (SNPs). Khi phân tích DGGE, cần có một số lượng ý nghĩa DNA để phát hiện, phản ứng chuỗi PCR được sử dụng để khuếch đại đoạn gen trước. Tất cả các vấn đề về đặc tính mẫu, ly trích DNA (hoặc RNA), sao chép ngược (nếu dung dịch chiết RNA), thiết kế mồi PCR, điều kiện cho phản ứng PCR, tinh sạch PCR trước khi sử dụng kỹ thuật DGGE. Phương pháp DGGE là một trong những phương pháp có độ nhạy cao, có thể nhanh chóng cung cấp đầy đủ những đặc tính đặc trưng của sự đa dạng về thành phần của cộng đồng vi sinh. Đồng thời sự thay đổi của cộng đồng vi sinh vật cũng có thể dễ dàng được chứng minh. Phân tích DGGE được sử dụng cho việc phân tách các mảnh DNA sợi đôi giống hệt nhau về chiều dài, nhưng khác nhau về trình tự. Trong thực tế, điều này đề cập đến việc phân tách các đoạn gene mong muốn bằng phương pháp PCR. Kỹ thuật khai thác (trong số những yếu tố khác) sự khác biệt trong kết nối ổn định G - C (3 liên kết hydro trong mỗi kết nối) trái ngược với kết nối A – T (2 liên kết hydro). Một hỗn hợp gồm các đoạn DNA khác nhau của trình tự khác nhau được điện di trong một môi trường polyacrylamide các sợi đôi đoạn DNA di chuyển tốt hơn, trong khi các phân tử DNA biến tính lại trở nên ít hiệu quả hơn hoặc không di chuyển trong gel. Nói chung, các đoạn DNA G – C sẽ ổn định hơn và vẫn còn sợi đôi cho đến khi đạt đến nồng độ cao hơn nồng độ ban đầu. Như vậy, các đoạn DNA của chuỗi khác nhau có thể được tách ra trong gel polyacrylamide. [20] 1.4.2. Các ứng dụng của DGGE trong xác định loài vi sinh vật Việc sử dụng kỹ thuật PCR và DGGE đã giúp cho các nhà khoa học tìm hiểu được sự đa dạng sinh học của vi sinh vật trong quần thề sinh vật (Muyzer và cộng sự, 1996). DGGE được sử dụng cho việc nghiên cứu đa dạng và sinh thái vi sinh vật trong các mẫu nguyên thủy hay còn gọi là mẫu môi trường (Heure và cộng sự, 1997). Thêm vào đó phương pháp này còn cho phép phân tích cả những đoạn gen có kích thước lớn như 16S rRNA thường được nhân bởi cặp mồi thông dụng. Trên 19
  21. Đồ án tốt nghiệp cơ sở những kết quả phân tích DGGE, xác định trình tự của cả những vi sinh vật nuôi cấy được và không thể nuôi cấy được trong điều kiện in – vitro. [3] Một trong những nhiệm vụ chính của sinh học phân tử là đánh giá được sự đa dạng của cộng đồng vi sinh vật hoặc những cấu trúc hiện có trong cộng đồng. Với nghiên cứu của Gavin và cộng sự (2005), DGGE được áp dụng để phân tích đa dạng của vi sinh vật môi trường, thực phẩm và cơ thể con người. [14] Phân tích DGGE đòi hỏi một lượng đáng kể DNA để phát hiện, phản ứng chuỗi polymerase PCR phải được thực hiện trước khi phân tích. Sử dụng DGGE để phân tích cộng đồng vi sinh đã được phát triển nhanh chóng, nó không những được sử dụng như một phương pháp phân tích biến đổi của cộng đồng vi sinh khi chịu ảnh hưởng của môi trường nữa mà còn dùng để ứng dụng cho giải trình tự. [16] Phân tích cộng đồng vi khuẩn bằng kỹ thuật DGGE bởi nghiên cứu của Muyzer và cộng sự (1993) được áp dụng rộng rãi để nghiên cứu đa dạng hệ vi khuẩn bằng sinh học phân tử liên quan đến đoạn gen 16S rDNA (Fries và cộng sự, 1997; Brinkhoff và cộng sự, 1998; Murry và cộng sự, 1998; Rosado và cộng sự, 1998; Bruns và cộng sự, 1999; Sievert và cộng sự, 1999), những đoạn gen thể hiện cả cộng đồng vi sinh nên tránh việc phân tích một hệ vi sinh quá rộng, người ta đã thực hiện nghiên cứu trên đoạn ngắn đặc hiệu hơn cho vi khuẩn là vùng V3 của đoạn 16S rDNA được chọn trong phân tích DGGE. DGGE có độ nhạy cao trong phân tích cộng đồng vi sinh, cung cấp thông tin nhanh chóng trong phân tích đa dạng vi sinh vật cả về số lượng lẫn chất lượng, không tốn nhiều thời gian. Các mồi sử dụng cho nghiên cứu cũng được đặc trưng cho từng loài vi khuẩn, được thiết kế để xác định đa dạng di truyền giữa các loài, chẳng hạn như Eukaryotes và Archaebacteria (Muyzer và cộng sự, 1993). Kỹ thuật này có lợi cho việc theo dõi biến đổi cộng đồng vi sinh khi chịu ảnh hưởng của sự thay đổi môi trường (Henckel và cộng sự, 1999), phát hiện vi sinh vật cụ thể sau khi cắt band (Muyzer và cộng sự, 1993; Santegoeds và cộng sự, 1998). PCR – DGGE khắc phục những khó khăn của mà việc nuôi cấy truyền thống còn hạn chế trong xác định đa dạng loài vi sinh vật, các phương pháp 20
  22. Đồ án tốt nghiệp truyền thống chỉ có thể phát hiện khoảng 1% sự đa dạng vi sinh vật (Iwamoto và cộng sự, 2000). [13] Bộ gen DNA vi khuẩn từ môi trường tăng sinh được ly trích theo mô tả của Ausubel và cộng sự (1991). Khuếch đại đoạn 16S rDNA bằng các mồi đặc hiệu của archaeal đã không đưa ra kết quả tích cực Gurtner và cộng sự (2001). Tuy nhiên khuếch đại đoạn 16S rDNA với cặp mồi đặc hiệu của vi khuẩn đã cho kết quả tích cực hơn. Đối với phân tích DGGE, đoạn 200bp của 16S rDNA được khuếch đại sử dụng cặp mồi 341F GC/518R Muyzer G và cộng sự (1993). PCR và DGGE được thực hiện như mô tả Schabereiter – Gurtner và cộng sự (2001) và Muyzer (1993). Kết quả phân tích DGGE cho thấy chỉ có một band rõ rệt thể hiện sự đa dạng của vi sinh vật thấp hơn khi được nuôi cấy trong các môi trường tăng sinh đặc trưng. [7] Một nghiên cứu của Atsuo S. (2005) đã thành công khi sử dụng kỹ thuật PCR – DGGE phân tích hệ vi sinh vật lên men kỵ khí rơm rạ. Hoạt tính lên men methanol của quần thể vi sinh trong rơm lúa đã được điều tra (Adachi và cộng sự, 1996; Joulian và cộng sự, 1996; Asakawa và cộng sự, 1998; Kaku và cộng sự, 2000). Cộng đồng vi sinh lên men kỵ khí rơm rạ được xác định bằng DGGE bởi Sugano và cộng sự (2005). Cùng nghiên cứu về hệ vi sinh phân giải rơm rạ có báo cáo của Tun và Kimura (2000), Tun và cộng sự (2002), Nakamura và cộng sự (2003) và Sugano (2005) cũng đã sử dụng kỹ thuật này xác định và giải trình tự các chủng vi khuẩn lên men kỵ khí rơm rạ trong quá trình phát triển của chúng. Từ những nghiên cứu tương tự đó, có thể so sánh hệ vi sinh trong các nghiên cứu và làm tiền đề cho các nghiên cứu tiếp theo. [5] 21
  23. Đồ án tốt nghiệp CHƯƠNG 2: VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1 Bố trí thí nghiệm Thời gian tiến hành thí nghiệm từ tháng 3/2012 – 7/2012. Các thí nghiệm được thực hiện tại phòng Vi sinh của Viện Sinh Học Nhiệt Đới, số 9/621 Xa Lộ Hà Nội, Khu phố 6, Phường Linh Trung, Quận Thủ Đức, TP. Hồ Chí Minh. 2.2 Vật liệu và thiết bị 2.2.1 Vật liệu - Đối tượng nghiên cứu: Rơm trước và sau khi xử lý được sử dụng làm cơ chất trong trồng nấm rơm. - Vị trí lấy mẫu: Ấp Định Mỹ, Xã Phong Hòa, Huyện Lai Vung, Tỉnh Đồng Tháp. Hình 2.1: Bản đồ thể hiện vị trí lấy mẫu ở xã Phong Hòa, Lai Vung, Đồng Tháp. 22
  24. Đồ án tốt nghiệp - Ngày lấy mẫu: 23.5.2012. - Gồm 7 mẫu rơm khác nhau ở các giai đoạn trước và sau xử lý sử dụng làm cơ chất trồng nấm rơm được lấy cho việc thí nghiệm.  Đặc điểm chung của các mẫu được lấy:  Các mẫu được lấy một cách ngẫu nhiên.  Rơm ở các giai đoạn trước và sau khi xử lý có màu vàng nâu với các độ sậm và nhạt khác nhau tùy vào từng giai đoạn theo yêu cầu trước khi trồng nấm.  Rơm ở các giai đoạn trồng nấm có độ ẩm và nhiệt độ đặc trưng khác nhau. 2.2.2 Hóa chất 2.2.2.1 Các hóa chất dùng ly trích DNA - Lysis buffer (100 mM Tris HCl pH = 8; 100 mM sodium EDTA pH = 8; 100 mM sodium phosphate pH = 8; 1,5 M NaCl và 1% CTAB). - Proteinase K (10 mg/ml). - SDS 10% (Sodium dodecyl sulphate). - Chloroform/isoamyl alcohol (24:1 v/v). - Isopropanol. - Ethanol 70% lạnh. - Nước cất 2 lần. 2.2.2.2 Các hóa chất dùng trong tinh sạch DNA Tinh sạch bằng Kit GFX PCR DNA and GEL Band Purification Kit: - Capture buffer type 3. - 3M sodium acetate pH5. - GFX MicroSpin column. - Wash buffer type 1. 23
  25. Đồ án tốt nghiệp - Elution buffer type 4. - Elution buffer type 6. 2.2.2.3 Các hóa chất dùng để chạy điện di DNA - Agarose. - TAE (Tris, Acid acetic, EDTA). - Ethidium bromide. - Dung dịch nạp mẫu (loading dye 6X). 2.2.2.4 Các hóa chất dùng cho phản ứng PCR - Nước khử ion. - dNTPs. - Buffer 10X có chứa Mg 2+. - DNA khuôn mẫu. - Taq polymerase. - Các cặp mồi được sử dụng: 27F 5’ – GA GTT TGA TCM TGG CTC AG – 3’ 1492R 5’ – TAC GGG TAC CTT GTT ACG ACT T – 3’ 2.2.2.5 Các hóa chất dùng cho phản ứng DGGE - Gel polyacrylamide. - TAE. - Thuốc nhuộm xanh SYBR Green. - Chất làm đông tụ gel Temed/PSA. - Dung dịch nạp mẫu - Cặp mồi được sử dụng cho PCR vùng V3 của đoạn 16S rDNA: 24
  26. Đồ án tốt nghiệp 517R 5’ – ATT ACC GCG GCT GCT GG – 3’ 357F – GC 5’ – CGC CCG CGC GCG GCG GGC GGG GCG GGG GCA CGG GGG CCT ACG GGA GGC AGC AG – 3’ - Cặp mồi sử dụng PCR vùng V3 của đoạn 16S rDNA sau khi thực hiện phản ứng DGGE: 517R 5’ – ATT ACC GCG GCT GCT GG – 3’ 357F 5’ – CCT ACG GGA GGC AGC AG – 3’ 2.2.3 Thiết bị và dụng cụ 2.2.3.1 Thiết bị - Máy khuấy từ, lò điện, máy vortex, máy đo pH. - Tủ lắc có điều nhiệt. - Bể ổn nhiệt. - Tủ sấy Prolabo. - Máy ly tâm lạnh loại lớn (dùng cho ống ly tâm lớn) và loại nhỏ (dùng cho eppendorf). - Bộ điện di. - Hộp đèn soi UV Uvitec. - Tủ lạnh. - Tủ đông – 200C Alaska. - Lò viba. - Hệ thống chụp hình điện di Bio – Rad. - Máy PCR Sprint Thermo Cycle. - Bộ Kit tinh sạch DNA sau khi ly trích: GFX PCR DNA and Gel band purification Kit. 25
  27. Đồ án tốt nghiệp - Bộ Kit QIAGEN tinh sạch sản phẩm PCR vùng V3 của đoạn gene 16S rDNA. - Bộ Kit QIAEX II tinh sạch và thu nhận DNA từ gel polyacrylamide. - Bộ chạy điện di trong phân tích DGGE. 2.2.3.2 Dụng cụ - Các loại pipetteman có dung tích từ 0,2 – 1000 µl và các đầu type tương ứng. - Cân phân tích. - Ống ly tâm lớn, eppendorf loại 1 µl; 1,5 µl. - Các loại dụng cụ thủy tinh chịu nhiệt (erlen, burcher, pipette ). - Buồng điện di. - Găng tay, khẩu trang, đồ bảo hộ. 2.3 Phương pháp nghiên cứu 2.3.1 Quy trình ly trích và thu nhận DNA tổng số  Quy trình tách chiết DNA tổng số được thực hiện theo các bước ở sơ đồ 2.1: Cân 5 g mẫu cho vào tube loại 50 ml Thêm vào 13,5 ml lysis buffer và sau đó thêm vào 100µl proteinase K (10 mg/ml) hoặc 100µl Lysozyme (10 mg/ml) Lắc ngay ở 37 0C trong 30 phút Thêm 3 ml SDS 20% và sau đó ủ ở 65 0C trong 40 phút, mỗi 20 phút lắc một lần Ly tâm ở 7000 vòng trong 5 phút ở 4 0C 26
  28. Đồ án tốt nghiệp Chuyển dịch nổi sang tube mới Ly trích dịch nổi cùng thể tích với Chloroform/isoamyl alcohol (24:1 v/v) Ly tâm 6500 vòng trong 5 phút ở 4 0C Chuyển dịch nổi (phase trên) vào tube 40 ml Thu nhận tổng số DNA với 0,6 thể tích isopropanol trong 20 phút, nhiệt độ phòng Ly tâm 13000 vòng trong 20 phút, nhiệt độ phòng Loại bỏ dịch nổi, rửa DNA với Ethanol 70% lạnh Ly tâm 13000 vòng trong 10 phút, nhiệt độ phòng Loại bỏ ethanol và làm khô bằng máy ủ nhiệt ở 60 0C Hòa tan DNA với khoảng 50 µl nước khử ion hoặc dung dịch TE Sơ đồ 2.1: Quy trình ly trích DNA tổng số 2.3.2 Quy trình tinh sạch DNA tổng số bằng sử dụng bộ Kit: GFX PCR DNA and Gel Band Purification Kit (GE Healthcare)  Quy trình tinh sạch DNA tổng số bằng sử dụng bộ GFX PCR DNA and Gel Band Purification Kit được diễn giải theo sơ đồ 2.2: 27
  29. Đồ án tốt nghiệp Trộn khoảng 7 µl Loading dye 6X và 30 µl DNA mẫu Chạy điện di trên gel agarose (1%) có Ethidium bromide khoảng 110 volts trong 40 phút Kiểm tra DNA band dưới tia UV, sau đó cắt band giếng có DNA trong khoảng 0,5×0,5 cm và cho vào eppendorf đã biết trước khối lượng, từ đó tính ra khối lượng gel có trong eppendorf Thêm vào eppendorf Capture buffer type 3 với tỷ lệ 1:1 so với lượng DNA band được cắt (không ít quá 300 µl Capture buffer type 3) Lắc và ủ mẫu ở 600 C trong 30 phút, mỗi 3 phút lắc một lần (Nếu dịch mẫu sau giai đoạn này có màu hồng sậm hoặc đỏ, thêm 10 µl 3M Sodium acetate pH5 và lắc nhẹ để mẫu chuyển màu vàng) Ly tâm mẫu 3000 vòng trong 1 phút Chuyển mẫu vào GFX column MicroSpin, ủ 1 phút ở nhiệt độ phòng Ly tâm 13000 vòng trong 1 phút Loại bỏ dịch sau ly tâm, đưa column vào lại eppendorf và lặp lại bước ly tâm ở 13000 vòng trong 1 phút, bỏ dịch Thêm 500 µl Wash buffer type 1 vào column Ly tâm 13000 vòng trong 1 phút, bỏ dịch và lặp lại bước ly tâm như trên 28
  30. Đồ án tốt nghiệp Chuyển GFX column vào eppendorf loại 1,5 ml Thêm 20µl Elution buffer type 4 hoặc type 6 vào giữa màng GFX column Ủ 1 phút ở nhiệt độ phòng Ly tâm 13000 vòng trong 1 phút, bỏ GFX column, bảo quản dịch lắng trong eppendorf ở điều kiện lạnh -200C Sơ đồ 2.2: Quy trình tinh sạch DNA tổng số 2.3.3 Khuếch đại đoạn gene 16S rDNA của nhóm vi khuẩn trong rơm bằng phương pháp PCR 2.3.3.1 Khuếch đại đoạn gen 16S rDNA Phản ứng khuếch đại đoạn gene 16S rDNA được thực hiện với cặp mồi chuyên biệt cho nhóm vi khuẩn là 27F/1492R.  Thành phần phản ứng PCR với tổng thể tích 50 µl ở bảng 2.1 Bảng 2.1: Thành phần phản ứng PCR với tổng thể tích 50µl. Thành phần phản ứng Thể tích DNA khuôn 2 µl 2X Master Mix (Roche) 25 µl Primer 27F (100 pmol/ µl) 0,5 µl Primer 1492R (100 pmol/ µl) 0,5 µl Nước khử ion 22 µl Tổng thể tích 50 µl 29
  31. Đồ án tốt nghiệp  Chu kỳ phản ứng PCR cho máy luân nhiệt: - Bước 1: 950 C trong 10 phút. - Bước 2: 930 C trong 1 phút. - Bước 3: 500 C trong 1 phút. - Bước 4: 720 C trong 2 phút. - Bước 5: 950C trong 30 giây. - Bước 6: 500C trong 2 phút. - Bước 7: 720C trong 2 phút. - Bước 8: Quay lại bước 5 đến bước 7, lặp lại 30 lần - Bước 9: 950 C trong 1 phút. - Bước 10: 500 C trong 1 phút. - Bước 11: 720 C trong 5 phút. - Bước 12: Ôn định ở 40 C  Điện di dung dịch đạt được sau phản ứng PCR trên gel agarose 1% để kiểm tra sản phẩm PCR tạo thành.  Kiểm tra DNA sau phản ứng PCR - Chuẩn bị bộ điện di. - Chuẩn bị gel agarose 1%. - Đun bằng lò viba cho đến khi agarose tan hoàn toàn, lắc đều. Để nguội cho đến khoảng 50 – 600 C. - Cho 2µl Ethidium bromide 5 mg/ml vào trong dung dịch Agarose tan chảy. - Nạp mẫu vào giếng trên gel với 3µl Loading dye và 5µl mẫu, chạy điện di khoảng 30 – 50 phút với nguồn điện 110 Volts. - Quan sát kết quả chạy điện di dưới hộp đèn UV 312 nm. 30
  32. Đồ án tốt nghiệp - Dựa vào mức độ sáng của sản phẩm điện di, ta có thể ước lượng được nồng độ DNA trong dung dịch tách chiết. Các mẫu dương tính là các mẫu có vạch sáng. 2.3.3.2 Tinh sạch sản phẩm PCR Trước khi phân tích DGGE đoạn gene đã được khuếch đại, ta phải tinh sạch mẫu nhằm loại bỏ các tạp chất còn lại trong lúc thực hiện phản ứng PCR và các bước thực hiện như sau: - Chuẩn bị bộ lọc để tinh sạch DNA. - Cho thêm 500µl dung dịch đệm Capture vào cột, ly tâm 13000 vòng trong 30 giây. - Bỏ phần dịch và thu phần đầu lọc phía trên. - Thêm 500µl dung dịch Wash buffer vào cột, ly tâm 13000 vòng trong 30 giây. - Bỏ phần dịch, thu phần đầu lọc phía trên đặt vào eppendorf mới. - Thêm 50µl Tris – HCl 10 mM hay nước khử ion. - Ly tâm 6000 vòng trong 30 giây. - Thu DNA tinh sạch. 2.3.4 Xác định thành phần nhóm vi khuẩn bằng DGGE Trước khi phân tích DGGE chúng ta phải khuếch đại đoạn gene 16S rDNA và tinh sạch nó. Đoạn gene 16S rDNA có kích thước khoảng 1600 bp. Trên đoạn gene này ta tiến hành PCR đoạn V3 để phân tích DGGE (kích thước đoạn V3 < 200 bp). 2.3.4.1. Phản ứng PCR đoạn V3 của DGGE: Được thực hiện với cặp mồi chuyên biệt cho nhóm vi khuẩn là 517R/357F – GC. Thành phần phản ứng PCR vùng V3 thuộc đoạn gene 16S rDNA của DGGE với tổng thể tích 50µl được trình bày ở bảng 2.2. 31
  33. Đồ án tốt nghiệp Bảng 2.2: Thành phần phản ứng PCR vùng V3 thuộc đoạn gene 16S rDNA của DGGE với tổng thể tích 50 µl. Thành phần phản ứng Thể tích Nước khử ion 21 µl 2X Master Mix 25 µl Primer 517R (45 pmol) 1,0 µl Primer 357F – GC (45 pmol) 1,0 µl DNA khuôn (16S rDNA) 2,0 µl Tổng 50 µl  Chu kỳ phản ứng PCR vùng V3 thuộc đoạn gene 16S rDNA của DGGE: . Bước 1: 950 C trong 10 phút. . Bước 2: 930 C trong 30 giây. . Bước 3: 650 C trong 40 giây. . Bước 4: 720 C trong 1 phút. . Bước 5: Quay lại bước 2. . Bước 6: 930 C trong 30 giây. . Bước 7: 600 C trong 40 giây. . Bước 8: 720 C trong 1 phút. . Bước 9: Quay lại bước 6 tới bước 8, lặp lại 9 lần. . Bước 10: 930 C trong 30 giây. . Bước 11: 550 C trong 40 giây. . Bước 12: 720 C trong 1 phút. 32
  34. Đồ án tốt nghiệp . Bước 13: Quay lại bước 10 tới bước 12, lặp lại 8 lần. . Bước 14: 930 C trong 30 giây. . Bước 15: 550 C trong 40 giây. . Bước 16: 720 C trong 5 phút. . Bước 17: Giữ mẫu ở 40C. Ghi nhận kết quả PCR và điện di kiểm tra trên gel agarose 2%.  Tiến hành tinh sạch sản phẩm sau khi PCR vùng V3 của đoạn 16S rDNA bằng QIAGEN Kit: Cắt gel có band DNA cho vào eppendorf và tính toán lượng gel đã cắt Thêm Buffer QX1 vào eppendorf với thể tích bằng 3 lần thể tích gel đã cắt Vortex mẫu trong 30 giây Thêm 10 µl QIAEX II nếu mẫu chứa ≤ 2 µg DNA; 30 µl nếu mẫu chứa 2 – 10 µg DNA; Và thêm 30 µl nữa nếu mẫu chứa ≥ 10 µg DNA. Lắc đều Ủ 500 C trong 10 phút để gel được tan hoàn toàn. Lắc mẫu 2 phút một lần. Mẫu lúc này có màu vàng, nếu dịch mẫu có màu cam hoặc tím ta thêm 10 µl 3M Sodium acetate pH 5.0 và lắc đều Ly tâm mẫu 13000 vòng trong 30 giây, loại dịch nổi bằng pipette Rửa phần lắng với 500 µl Buffer QX1. Lắc nhẹ và ly tâm mẫu 13000 vòng trong 30 giây. Loại dịch nổi 33
  35. Đồ án tốt nghiệp Rửa phần lắng 2 lần với 500 µl Buffer PE. Lắc nhẹ và ly tâm mẫu như trên, loại bỏ phần dịch nổi có chứa muối Làm khô mẫu 15 – 30 phút ở nhiệt độ phòng cho đến khi mẫu có màu trắng Thêm 20 µl Tris – Cl 10 mM pH 8,5 hoặc TE buffer và lắc đều Ủ 5 phút ở nhiệt độ phòng, ly tâm 13000 vòng trong 30 giây Chuyển dịch nổi vào eppendorf sạch khác, mẫu lúc này có chứa DNA đã tinh sạch Sơ đồ 2.3: Quy trình tinh sạch sản phẩm sau khi PCR vùng V3 của đoạn 16S rDNA bằng QIAGEN Kit. 2.3.4.2. Phương pháp DGGE  Thiết lập bộ gel polyacrylamine: Đây là gel dùng trong phương pháp DGGE. Nồng độ pha gel polyacrylamine được pha theo bảng 2.3: Bảng 2.3: Nồng độ pha gel polyacrylamine 0 % UF 50 % UF 0 % UF 80 % UF 6 % PA 6 % PA 12 % PA 12 % PA 20X TAE 12,5 ml 5 ml 5 ml 5 ml Acrylamine 30 g 12 g 74 g 24 g Bis – 0,8 g 0,324 g 0,684 g 0,648 g Acrylamine Urea 0 g 42 g 0 g 62,2 g Formamide 0 ml 40 ml 0 ml 64 ml Total 500 ml 40 ml 0 ml 200 ml 34
  36. Đồ án tốt nghiệp Sau khi pha gel polyacrylamide theo bảng 2.3, tiến hành phối trộn các nồng độ này vào hai xilanh. + Xilanh 1: Tương ứng với nồng độ cao. + Xilanh 2: Tương ứng với nồng độ thấp. Tỷ lệ phối trộn vào 2 xilanh như bảng 2.4: Bảng 2.4: Tỷ lệ phối trộn gel polyacrylamide vào hai xilanh 0 % UF 50 % UF 0 % UF 80 % UF Thể tích 6 % PA 6 % PA 12 % PA 12 % PA Xilanh 1 9,6 ml 6,4 ml 16 ml Xilanh 2 4 ml 12 ml 16 ml Sau đó cho thêm 100 µl Temed/PSA (50 µl) để đông tụ gel polyacrylamide.  Các bước thực hiện trong phương pháp DGGE - Bước 1: Chuẩn bị dung dịch đệm và pha gel polyacrylamide. Dung dịch đệm thường sử dụng trong bản gel polyacrylamide là TBE (TBE: Tris – Boric acid – EDTA) hoặc TAE (TAE: Tris – Acetic acid – EDTA). Gel polyacrylamide được pha theo tỷ lệ phối trộn như bảng 2.4 và được cho vào ống xilanh với hai nồng độ khác nhau. Sau khi bơm gel polyacrylamide vào buồng điện di, hai nồng độ này sẽ trộn lẫn vào nhau. Tiến hành đặt lược vào buồng điện di để bơm mẫu vào giếng. - Bước 2: Nạp mẫu vào giếng. Mẫu DNA sau khi tinh sạch được bơm vào giếng - Bước 3: Chạy điện di. Trước khi điện di phải đảm bảo nhiệt độ trong bể là 610C. Điện áp chạy điện di khoảng 600 Volts, trong thời gian là 300 phút. 35
  37. Đồ án tốt nghiệp - Bước 4: Sau khi chạy điện di xong, tách các tấm gel, sau đó cho vào khay để nhuộm gel bằng thuốc nhuộm xanh SYBR Green. - Bước 5: Đặt gel dưới tấm kính của hộp đèn soi UV Uvitec để xem các kết quả DGGE mẫu. Quan sát dưới tia UV, sau đó tiến hành cắt band cần nghiên cứu, tinh sạch và tiếp tục PCR mẫu vừa thu được. Thực hiện các bước tương tự như trên cho đến khi thu được các band riêng biệt của mẫu cần nghiên cứu. Lúc đó kết quả DGGE là tốt nhất. 2.3.4.3. Quy trình tinh sạch mẫu sau khi cắt band DNA của sản phẩm DGGE điện di trên gel polyacrylamide Sử dụng bộ Kit: Gel Extraction Kit of QIAEX II để tinh sạch và thu nhận DNA từ gel polyacrylamide. Cắt gel theo band cho vào eppendorf Thêm 300 µl Ethanol 100% Ly tâm 13000 rpm/phút. Loại bỏ Ethanol và để cồn bay hơi hết ở nhiệt độ phòng hoặc sấy khô Thêm 200 µl Diffusion buffer (DFB). Ủ ở 500 C trong 30 phút Ly tâm 13000 vòng trong 1 phút Loại bỏ dịch nổi, thêm Buffer QX1 bằng 3 lần thể tích mẫu Thêm 10 µl 3M Sodium acetate pH5 vào dung dịch nếu mẫu có màu cam hoặc hồng tím. Màu của mẫu nên có là màu vàng Vortex mẫu trong 30 giây 36
  38. Đồ án tốt nghiệp Thêm 10 µl QIAEX II và lắc đều. Ủ ở nhiệt độ phòng trong 10 phút, vortex mỗi 2 phút một lần Ly tâm mẫu 13000 vòng trong 30 giây và loại dịch nổi Thu phần lắng và rửa hai lần với 500 µl Buffer PE Làm khô phần lắng trong 10 – 15 phút cho đến khi trở thành màu trắng Thêm 20 µl Tris – Cl 10 mM, pH 8,5 hoặc nước cất rồi voxter. Ủ 5 phút ở nhiệt độ phòng Ly tâm 13000 vòng trong 30 giây, chuyển dịch nổi chứa DNA tinh sạch vào tube khác Sơ đồ 2.4: Quy trình tinh sạch và thu nhận DNA từ gel polyacrylamide bằng Gel Extraction Kit of QIAEX II 2.3.4.4. PCR vùng V3 thuộc đoạn gene 16S rDNA sau khi phân tích DGGE Trước khi đi vào Big – dye PCR để giải trình tự, tiến hành PCR vùng V3 sau khi thực hiện DGGE. Được thực hiện với hai cặp mồi chuyên biệt cho nhóm vi khuẩn là 517R và 357F. Thành phần phản ứng PCR vùng V3 thuộc đoạn gene 16S rDNA sau phản ứng DGGE với tổng thể tích 50 µl được trình bày ở bảng 2.5: 37
  39. Đồ án tốt nghiệp Bảng 2.5: Thành phần phản ứng PCR vùng V3 thuộc đoạn gene 16S rDNA sau phản ứng DGGE với tổng thể tích 50µl. Thành phần phản ứng Thể tích Nước khử ion 22,5 µl 2X Master Mix (Roche) 25 µl Primer 517R (45 pmol) 1 µl Primer 357F (45 pmol) 1 µl DNA khuôn (16S rDNA) 0,5 µl Tổng 50 µl Chu kỳ phản ứng PCR vùng V3 thuộc đoạn gene 16S rDNA cũng tương tự như chu kỳ phản ứng PCR vùng V3 của DGGE. 2.3.4.5. Quy trình Big – Dye PCR trước khi giải trình tự đoạn gene Sau khi tinh sạch và thu nhận được DNA từ gel polyacrilamide bằng Gel Extraction Kit of QIAEX II, tiến hành giải trình tự vùng V3 thuộc đoạn gene 16S rDNA trực tiếp trên máy xác định trình tự nucleotide tự động với bộ hóa chất sinh chuẩn Big – Dye PCR với cặp mồi 357F/517R. Thành phần của Big – Dye PCR được thể hiện trong bảng 2.6: 38
  40. Đồ án tốt nghiệp Bảng 2.6: Thành phần Big – dye PCR Thành phần Thể tích DNA 13 µl Primer 357F (3,2 pmol) hoặc 1 µl Primer 517R (3,2 pmol) Taq buffer for sequencing 2 µl Big – dye solution 4 µl Tổng 20 µl Sau khi có thành phần Big – Dye PCR là 20 µl, quy trình thực hiện với các bước tiếp: - Thêm 5µl EDTA 125 mM vào dung dịch Big – dye. - Thêm 60 µl Ethanol 100%. Tổng cộng thể tích dung dịch phản ứng là 85µl. - Giữ mẫu ở - 200 C trong 20 phút. - Ly tâm 13000 vòng trong 30 phút ở 40 C. - Loại Aluminm seal và bọc lại gel bằng giấy. - Ly tâm 13000 vòng trong 5 giây, loại bỏ cồn. - Thêm 85µl Ethanol 70% với tỷ lệ 1:1 (v/v). - Ly tâm 13000 vòng trong 15 phút ở 40C. - Loại aluminm seal và bọc lại gel bằng giấy. - Ly tâm 13000 vòng trong 5 giây và loại cồn. - Làm khô mẫu trong 15 phút bằng nhiệt. - Thêm 18µl HiDi – formamide trên mỗi mẫu và vortex. - Ly tâm 13000 vòng trong vài giây. - Đưa mẫu vào máy giải trình tự. 39
  41. Đồ án tốt nghiệp Giải trình tự dựa trên so sánh trình tự gene vùng V3 của đoạn 16S rDNA vi khuẩn với các đoạn gene tương đồng trong ngân hàng dữ liệu gene NCBI. Sử dụng các chương trình và hình thành cây phân loài:  Editseq  Megalign   40
  42. Đồ án tốt nghiệp CHƯƠNG 3: KẾT QUẢ VÀ THẢO LUẬN 3.1 Kết quả ly trích và thu nhận trực tiếp DNA vi khuẩn từ rơm trước và sau khi xử lý  Các mẫu rơm thu từ ấp Định Mỹ, xã Phong Hòa, Huyện Lai Vung, Tỉnh Đồng Tháp được ký hiệu như sau: - RT: mẫu rơm tươi (1 mẫu). - R2T: mẫu rơm trên luống đang trồng nấm được 2 tuần (2 mẫu). - R4: 2 mẫu rơm trên luống trồng nấm được 4 ngày (2 mẫu). - R2: 2 mẫu rơm ủ 2 ngày chưa phân luống (2 mẫu).  Một số hình ảnh ly trích và thu nhận trực tiếp DNA vi khuẩn từ các mẫu rơm: RT R2 R4 R2T R2 RT R2 R4 R2T Hình 3.1: Mẫu sau khi thêm 13,5ml Lysis Hình 3.2: Mẫu sau khi ủ 650C trong 40 buffer và 100µl lysozyme (10mg/ml) phút 41
  43. Đồ án tốt nghiệp RT R2 R4 R2T R2 R4 RT RT R2 R4 R2T R2T Hình 3.3: Mẫu sau khi ly tâm Hình 3.4: Sau khi cho chloroform/isoamyl alcohol 7000 vòng trong 5 phút (24:1 v/v) và ly tâm 6500 vòng trong 10 phút. RT RT R2 R2 R2T R2T R4 R4 Hình 3.5: Sau khi cho isopropanol, ủ 20 phút ở nhiệt độ phòng và ly tâm 13000 vòng trong 20 phút. Sau khi quá trình ly trích mẫu kết thúc, mẫu được làm khô và thêm TE buffer vào giúp bất hoạt enzyme nuclease góp phần bảo vệ DNA vi khuẩn. Mẫu DNA thu nhận được sau quá trình ly trích như các hình 3.1, 3.2, 3.3, 3.4, 3.5 cho kết quả rất tốt, tiến hành kiểm tra DNA vi khuẩn có trong mẫu sau ly trích bằng phương pháp điện di trên gel agarose 1%. 42
  44. Đồ án tốt nghiệp  Kết quả chạy điện di DNA vi sinh tổng số thu nhận từ quá trình ly trích 8 mẫu rơm: R2 R4 R4 R2T R2T RT RT R2 R2 R4 R4 R2T R2T RT RT R2 Hình 3.6: Kết quả điện di lần 1 Hình 3.7: Kết quả điện di lần 2 Với kết quả điện di như hình 3.6 và 3.7, sử dụng 5µl mẫu chạy điện di thì nhìn chung các mẫu đều cho kết quả DNA rất tốt. Tuy nhiên một số mẫu còn không tốt như hình 3.6, mẫu R2T và R2 vạch không rõ ràng, tiến hành ly trích lần 2 và điện di thu được kết quả tốt hơn ở hình 3.7, các mẫu thể hiện các band rõ hơn trên nền agarose. Từ kết quả ly trích với hàm lượng DNA thu được, tiếp tục tinh sạch các mẫu sau khi điện di. 43
  45. Đồ án tốt nghiệp 3.2 Kết quả tinh sạch sau khi tinh sạch DNA vi khuẩn bằng bộ Kit GFX PCR DNA and GEL Band Purification Sau khi ly trích mẫu thu nhận DNA tồng số vi sinh vật với kết quả rất tốt ở hình 3.7, tiến hành tinh sạch DNA, kết quả điện di thu nhận sau khi tinh sạch ở hình 3.8. R2 R2 R4 R4 R2T R2T RT RT Hình 3.8: Các mẫu sau khi tinh sạch bằng Kit GFX PCR DNA and GEL Band Purification Kit. Nhìn chung các mẫu sau khi tinh sạch như trên hình 3.8 cho kết quả không được tốt, lượng DNA không phải là một vạch rõ ràng mà hình thành từng vệt mờ. Chỉ có mẫu R2T và R2 là xác định được band DNA cụ thể, các mẫu còn lại không có kết quả tốt lắm. Nguyên nhân có thể do quá trình thao tác chưa tốt, thời gian quy định của từng giai đoạn chưa chính xác theo yêu cầu của quy trình. Tiến hành điện di lại các mẫu nhưng kết quả vẫn không tốt hơn hình 3.9. Do đó, thao tác bước tiếp theo là khuếch đại đoạn gene 16S rDNA nhằm thu nhận số lượng DNA lớn hơn. 3.3 Kết quả khuếch đại đoạn gene 16S rDNA các mẫu DNA tinh sạch Khuếch đại đoạn gene 16S rDNA của các mẫu sau tinh sạch bằng phản ứng PCR với cặp mồi 27F/1492R. Đoạn gene 16S rDNA có kích thước khoảng 1600bp. Sản phẩm điện di sau khi PCR đoạn 16S rDNA của vi khuẩn thể hiện ở hình 3.9 44
  46. Đồ án tốt nghiệp RT R2 R4 R2T RT R2 R4 1600 bp Hình 3.9: Sản phẩm điện di sau khuếch đại đoạn gene 16S rDNA. Như kết quả ở hình 3.9, cho thấy ở lần điện di đầu tiên chỉ có mẫu R2T cho kết quả tốt, các mẫu còn lại không thấy xuất hiện band DNA, nguyên nhân làm cho việc thu nhận DNA sau khi trải qua bước tinh sạch không tốt có thể là do hàm lượng DNA trong mẫu không đều khi tiến hành load để điện di, hoặc là do thao tác chưa thành thạo nên dẫn đến lỗi trong quá trình thí nghiệm ảnh hưởng đến kết quả. Các mẫu RT, R2 và R4 được tiến hành điện di lại lần 2 và thu được kết quả tốt hơn. Sau khi thu được các mẫu với kết quả tốt như vậy, tiến hành phương pháp xác định nhóm vi khuẩn bằng DGGE. 3.4 Kết quả xác định nhóm vi khuẩn bằng phương pháp DGGE  Sau khi sản phẩm PCR được khuếch đại, sản phẩm được tinh sạch trước khi thực hiện phương pháp DGGE, điện di sản phẩm PCR đoạn 16S rDNA sau khi tinh sạch cho ra kết quả như hình 3.10: 45
  47. Đồ án tốt nghiệp RT R2 R4 R2T 1600bp Hình 3.10: Các mẫu chạy điện di sau khi tinh sạch đoạn 16S rDNA Sau khi tinh sạch mẫu với kết quả rất tốt như hình 3.10, trên đoạn gene 16S rDNA có kích thước 1600 bp, tiếp tục phân tích DGGE vùng V3 có kích thước < 200 bp, sử dụng cặp mồi 517R/357F – GC.  Tiến hành PCR vùng V3 của 16S rDNA: Phản ứng PCR khuếch đại đoạn V3 của 16S rDNA với cặp mồi 517R/357F – GC để phân tích DGGE đặc trưng của nhóm vi khuẩn. RT RT R2 R2 R4 R4 R2T R2T 200 bp Hình 3.11: Kết quả chạy PCR vùng V3 thuộc đoạn gene 16S rDNA. 46
  48. Đồ án tốt nghiệp  Để phân tích DGGE đạt kết quả tốt nhất cần phải tinh sạch mẫu nhằm loại bỏ các tạp chất còn lại trong lúc thực hiện phản ứng PCR. RT R2 R4 R2T 200 bp Hình 3.12: Kết quả tinh sạch vùng V3 của đoạn gene 16S rDNA. Kết quả thu nhận được ở hình 3.12 rất tốt, cả 4 mẫu đều có DNA sau khi tinh sạch vùng V3 của đoạn 16S rDNA. Tiến hành tính nồng độ nucleotide vùng V3 thích hợp để thực hiện DGGE hiệu quả nhất. Sử dụng máy BECKMAN DU – 7000, đo ở bước sóng 260 – 280nm và tiến hành DGGE lần 1 như hình 3.13. 3.4.1 Kết quả DGGE lần 1: RT R2 R4 R2T RT R2 R4 R2T 1 1 2 2 3 3 4 5 4 6 5 7 6 7 a) b) Hình 3.13: Kết quả sản phẩm DGGE lần 1 với nồng độ pha loãng 10-1 (hình 3.13a) và 10-2 (hình 3.13b). 47
  49. Đồ án tốt nghiệp Với kết quả DGGE như hình 3.13 cho thấy các mẫu đều xuất hiện nhiều band, vì vậy tiến hành cắt band và PCR lại nhằm thu các band rõ ràng hơn. Để khuếch đại đoạn gene này sử dụng nồng độ pha loãng mẫu 10-1 vì các band này tốt -2 hơn so với độ pha loãng 10 . Sử dụng hai mẫu rơm tươi (RT) và rơm 2 ngày (R2) để tiếp tục DGGE lần 2 nhằm thu được kết quả tốt nhất. - Mẫu RT sau khi cắt band gồm: RT1, RT2, RT3, RT4, RT5, RT6, RT7. - Mẫu R2 sau khi cắt band gồm: R2.1, R2.2, R2.3, R2.4, R2.5, R2.6, R2.7.  Kết quả điện di và tinh sạch sau khi khuếch đại đoạn gene của hai mẫu rơm RT và R2 bằng phương pháp PCR vùng V3 của đoạn 16S rDNA: 1 2 3 4 5 6 7 1 2 3 4 5 6 7 b) a) Hình 3.14: Kết quả PCR vùng V3 mẫu RT (a) và R2 (b) sau khi DGGE lần 1. 1 2 3 4 5 6 7 1 2 3 4 5 6 7 a) b) Hình 3.15: Tinh sạch sản phẩm PCR vùng V3 đoạn 16S rDNA của sản phẩm DGGE lần 1 với mẫu RT (a) và R2 (b). 48
  50. Đồ án tốt nghiệp Từ kết quả ở hình 3.14 và 3.15 cho thấy hàm lượng DNA thu được sau khi PCR và tinh sạch vùng V3 rất tốt, các mẫu sau khi kiểm tra bằng điện di thể hiện các band rõ và đồng đều, từ đây tiến hành DGGE lần 2 với hai mẫu RT và R2. 3.4.2 Kết quả DGGE lần 2: 2 1 3 2 1 5 4 3 6 4 7 5 6 7 a) b) Hình 3.16: Kết quả điện di sản phẩm DGGE lần 2 với 2 mẫu rơm: R2 (hình 3.16a) và RT (hình 3.16b). Với kết quả như hình 3.16 trên cho thấy các mẫu RT1, RT4, RT5, RT6, R2.2, R2.3, R2.7 đều có band rất tốt, rõ ràng, có hàm lượng DNA đáng kể. Các mẫu này sẽ được tiếp tục tiến hành PCR vùng V3 với cặp mồi 357F/517R, sau đó chúng được tinh sạch bằng QIAEX II và tiến hành giải trình tự trước khi thành lập cây phân loài. 49
  51. Đồ án tốt nghiệp  Các mẫu có kết quả tốt như RT1, RT4, RT5, RT6, R2.2, R2.3, R2.7 được PCR với cặp mồi 357F/517R và tinh sạch bằng QIAEX II vùng V3: RT1 RT4 RT5 RT6 R2.2 R2.3 R2.7 Hình 3.17: Kết quả các mẫu sau khi PCR vùng V3 với cặp mồi 357F và 517R. RT1 RT4 R2.7 RT5 R2.3 RT6 RT6 R2.2 Hình 3.18: Kết quả điện di các mẫu sau khi tinh sạch bằng QIAEX II. Với kết quả như hình 3.17 và 3.18, các mẫu thu nhận sau khi PCR và tinh sạch bằng QIAEX II cho kết quả rất tốt, các band xuất hiện rõ và đồng đều, có thể tiến hành bước giải trình tự loài với các mẫu này. 50
  52. Đồ án tốt nghiệp  Với mẫu RT2 và R2.6 sau khi DGGE lần 2 (hình 3.16) không cho thấy kết quả nên sẽ được tiến hành PCR lại lần 2. Các mẫu RT3, RT7, R2.1, R2.4 và R2.5 (hình 3.16) xuất hiện hai band, chính vì vậy tiến hành cắt band và PCR vùng V3 để khuếch đại các đoạn gene này cho DGGE lần 3.  Tiến hành PCR lại vùng V3 các sản phẩm DGGE lần 2 chưa tốt: RT2 RT3.1 RT3.2 RT7.1 RT7.2 R21.1 R21.2 R2.4 R2.5 R2.6 Hình 3.19: Kết quả PCR vùng V3 của các mẫu lần 2. Sau khi cắt band và khuếch đại đoạn gene bằng phương pháp PCR có các mẫu: - Mẫu RT2. - Mẫu RT3 gồm: RT3.1 và RT3.2. - Mẫu RT7 gồm: RT7.1 và RT7.2. - Mẫu R2.1 gồm: R2.1.1 và R2.1.2. - Mẫu R2.4, Mẫu R2.5, Mẫu R2.6. 51
  53. Đồ án tốt nghiệp  Kết quả sau khi tinh sạch sản phẩm PCR vùng V3 của đoạn 16S rDNA sau khi thực hiện phương pháp DGGE lần 2: b) 1.1 1.2 4 5 6 a) 2 3.1 3.2 7.1 7.2 Hình 3.20: Kết quả điện di mẫu RT (hình 3.20a) và R2 (3.20b) sau tinh sạch sản phẩm PCR vùng V3 sau khi thực hiện phương pháp DGGE lần 2. Với hình 3.20 cho thấy các mẫu sau khi tinh sạch sản phẩm PCR vùng V3 đều cho kết quả rất tốt, mỗi mẫu chỉ xuất hiện duy nhất một band tương ứng và rõ ràng, do đó có thể tiếp tục tiến hành DGGE lần 3 các mẫu này. 52
  54. Đồ án tốt nghiệp 3.4.3 Kết quả DGGE lần 3: RT2 R2.6 RT3.1 R2.5 RT3.2 R2.4 R2.1.2 RT7.1 R2.1.1 RT7.2 Hình 3.21: Kết quả điện di DGGE lần 3. Dựa vào kết quả hình 3.21 cho thấy sản phẩm DGGE lần 3 đem lại kết quả rất tốt, các band xuất hiện rõ hơn và chỉ có một band cho mỗi mẫu tương ứng. Từ những kết quả DGGE ở trên, tiếp tục tiến hành PCR vùng V3 với cặp mồi 357F/517R cho các mẫu còn lại sau DGGE lần 3, sau đó chúng được tinh sạch bằng QIAEX II và tiến hành phản ứng Big – Dye PCR vùng V3 với cặp mồi 357F/517R. 53
  55. Đồ án tốt nghiệp  PCR vùng V3 cho các mẫu sau DGGE lần 3: 2 6 3.1 5 3.2 4 7.1 1.2 7.2 1.1 2 a) b) Hình 3.22: Kết quả các mẫu RT (a) và R2 (b) sau khi PCR vùng V3 với cặp mồi 357F/517R. 2 3.1 6 3.2 4 5 7.1 1.2 7.2 1.1 a) b) Hình 3.23: Kết quả điện di mẫu RT (a) và R2 (b) sau khi tinh sạch vùng V3 bằng QIAEX II Với kết quả khuếch đại và tinh sạch vùng V3 của đoạn 16S rDNA ở hình 3.22 và 3.23 cho thấy rất tốt, tiến hành giải trình tự vùng V3 trực tiếp trên máy xác định trình tự nucleotide tự động với bộ hóa chất sinh chuẩn Big – Dye PCR cùng cặp mồi 357F/517R. Kết quả trình tự mồi xuôi và mồi ngược của các chủng vi khuẩn ở mỗi mẫu được thể hiện ở phần Phụ lục C. 54
  56. Đồ án tốt nghiệp 3.5 Giải mã trình tự đoạn gene vùng V3 thuộc đoạn 16S rDNA của vi khuẩn Trình tự đoạn gene vùng V3 thuộc đoạn 16S rDNA của các chủng vi khuẩn ở mỗi mẫu rơm được thể hiện: - RT1: ATCAGCCATGCCGCGTGTGTGAGACGGCCTTCTGGTTGTAAAACTCTTTTTGTTGGGAGG AAGGCCAGTATGCTAATACCTTGCTGTTTTGACTTTACCGATAGAATACGCACCGGCTAA CTTTGTGCCAGCAGCCGCTATAATAAAA - RT2: CAAGCCACGTGAGTGACGAAGGCCTTATTGTTGTAAAGCTAATAGCTTGGGAGGAAGTA TTCTCGCGAGTACCCGAGTGGCTTGACCGTACCTTGCCAGAAAGGCCGGTCTACTTCTTG CCCCAGCCGCTATAATA - RT3.1: AGCAGCCATGCCGCGTGCGTGACGACTGCCCTATGGGTTGTAAACTGCTTTTGCAACGG GGAAGAAACCTAGTTACGTGTAGATACCTGAAGGACCAGGAGAA - RT3.2: AAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGCTTTCGGGTCGTAAAACTCTGTT GTTAGGGAAGAACAAGTACGAGAGTAACTGCTCGTACCTTGACCGTACC - RT4: CAGCCATGCCGCGTGAGTGATGAAGGCCTTAGGGTTGTAAAGCTCTTTCACCGAGGAAG ATAATGACGGT - RT5: ATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAA GCTCTTTCACCGGGGAAGATAATGACGGTAACCGGAGAAGAAGCCC - RT6: GCAGCCTGATGCAGCCATGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTTTC ACGGGGAAGAAGGGGACGGGACCGATCCTGCAGACA - RT7.1: CTGATGCAGCGACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCA GGGAAGAAGCGAAAGTGACGGTACCTGCAAAAG 55
  57. Đồ án tốt nghiệp - RT7.2: AATGGGCGCAAACGCTGATGCAGCCTGCCGCGTGAGGTGATGAAGGCCTTCGGGTTGTA AAGCTCTTTCAACAGGGACGAAGATGACGGTACCGGTAGAAGAAA - R2.1.1: AATGGAGGGAACTCTGAACCAGCCATGCCGCGTGCAGGATGACTGCCCTATGGGTTGTA AACTGCTTTTGTACGGGAATAAACACTGATACGTGTATCAGCTTGAA - R2.1.2: AGCCCGATGGAGCAACCCCGCGTGCAGGAAGAAGCCTTTCGGGGGAAAACCCTTTTATA AGTTAAGAATATGACGGTAACTTATGAATATTGCCGGCTAACTACGAATCCGGCTCCCCT AACTCCGTGCCAGCAGCCGCGGTAATAA - R2.2: ATGGAGGCAACTCTGACCCAGCCATGCCGCGTGCAGGAAGAAGGTCCTCTGGATTGTAA ACTGCTTTTGAATGGGAAGAAACGTAGTCTTGCGAGGCTATTTGACGGTACTATTAGAAT A - R2.3: AGCCTGATCCAGCGATGCCGCGTGAGTTAAACAGGCTTTAGGGTTGGAAAAACTTTTCCT TACGGAAGAAAATGACCCCTCCTGAGGAATATTGTCCGGACCATTCCAAGCCAGATCGC CTAACTCTATGCCAGCAGCCGCGGTAATAAAAT - R2.4: AGCCATGCCGCGTGCGTGATGAAGGCCTTATGGTTGGAAATAGAAGAAGCCCCGTCCAA CTTCAAGCCGGCTCCCCTAATTCTGTGCCAGCAGCCGCGGTAATAACTA - R2.5: GGGGAAGCCTGATCCAGCCATGCCGCGTGCGTGATGAAGGCCTTATGGTTGTAAAGCTC TTTTTGTCGGAAGATAACG - R2.6: GGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCTTAGGGTTGTAAAGC TCTTTTACCGGGGAAGATAATGACGGTAGCCGGAGAAGAAGC - R2.7: ATGGGCGCAAGCCTGATCCAGCCATGCTGCGTGAGTGATGAAGGCCTTAGGGTTGTAAA GCTCTTTCTCCGGTGAAGATAATGACGGTACCCGGAGAAGAAGCCCCG Với kết quả giải trình tự đoạn gene vùng V3 thuộc 16S rDNA của vi khuẩn cho thấy rất tốt, chẳng hạn như các chủng RT3.2, RT4, RT5, RT7.1, R2.2, R2.6, R2.7 có độ 56
  58. Đồ án tốt nghiệp tương đồng di truyền cao khi so sánh trong ngân hàng gene NCBI, sự tương đồng được thể hiện rõ hơn trong cây phân loài ở hình 3.24 và 3.25. Tuy nhiên, một số chủng như RT2, R2.3 và R2.4 sau khi xác định trình tự nucleotide tự động với bộ hóa chất sinh chuẩn Big – Dye PCR cùng cặp mồi 357F/517R cho trình tự cặp mồi không tốt, các peak đè chồng lên nhau thể hiện ở phần Phụ lục C, do đó trình tự đoạn gene vùng V3 của những mẫu này không cho thấy có sự tương đồng di truyền với loài nào trong Genebank. 3.6 Hình thành cây phân loài của nhóm vi khuẩn trong rơm trước và sau khi xử lý Để giải trình tự đoạn gene vùng V3 của vi khuẩn có ở các mẫu rơm, sử dụng phần mềm Editseq, so sánh và tìm các đoạn gene tương đồng trong ngành dữ liệu gen tại website Sau đó xây dựng cây phát sinh loài với phần mềm MegAlign. 57
  59. Đồ án tốt nghiệp Hình 3.24: Cây phân loài mẫu rơm tươi (RT) 58
  60. Đồ án tốt nghiệp Hình 3.25: Cây phân loài của mẫu rơm ủ 2 ngày (R2) Kết quả thành lập cây phân loài của mẫu rơm tươi (RT) và rơm ủ 2 ngày (R2) được thể hiện ở hình 3.24 và 3.25 cho thấy sự khác nhau về hệ vi khuẩn có trong hai mẫu rơm. Sự khác biệt đó là do ảnh hưởng của thay đổi điều kiện môi trường sống như nhiệt độ, oxy tiêu thụ và độ ẩm của rơm. Ở giai đoạn rơm tươi (RT) trước khi xử lý, rơm ở điều kiện tự nhiên, nhiệt độ, độ ẩm và oxy phù hợp cho các chủng hiếu khí phát triển mạnh, hệ vi khuẩn tương đồng với các chủng của mẫu rơm tươi (RT) thể hiện rõ ở hình 3.24, có thể thấy một số chủng có độ tương đồng cao với các loài vi khuẩn như RT3.2 tương đồng với chủng Bacillus đến 99% gồm có hai loài Bacillus cereus, Bacillus aryabhattai, RT4 tương đồng di truyền với Candidatus Rhizobium massiliae cũng là 99%, loài Ochrobactrum có độ tương đồng với RT5 là 99% như Ochrobactrum rhizosphaerae. Sau khi rơm được ủ 2 ngày, nhiệt độ và độ ẩm của rơm tăng lên, lượng oxy không khí giảm sẽ gây ức chế sự phát triển của một số loài hiếu khí kém chịu nhiệt, 59
  61. Đồ án tốt nghiệp thay vào đó các chủng kỵ khí hoặc kỵ khí tùy nghi, chịu nhiệt và ưa ẩm phát triển mạnh mẽ, ức chế các chủng hiếu khí ban đầu có trong rơm tươi. Hệ vi khuẩn thay đổi thể hiện rõ ở cây phân loài hình 3.25. Các chủng vi khuẩn R2 có sự tương đồng di truyền cao, cao nhất là chủng R2.2 có sự tương đồng lên đến 100% với loài Leadbetterella byssophila, do đó R2.2 có khả năng là loài này. R2.6 và R2.7 đều có độ tương đồng di truyền với Agrobacterium tumefaciens là 97%. R2.5 cũng tương đồng 97% với loài Sphingomonas pituitosa. Như vậy, hệ vi khuẩn trong rơm ở hai điều kiện khác nhau sẽ có sự phân bố các loài khác nhau. Tùy vào đặc điểm sinh lý mỗi loài thích nghi với điều kiện môi trường để phát triển và ức chế các loài khác. 60
  62. Đồ án tốt nghiệp CHƯƠNG 4: KẾT LUẬN VÀ ĐỀ NGHỊ 4.1 Kết luận Qua quá trình làm đồ án với các thí nghiệm của đề tài, một số kết quả đã thu được như sau:  Đã ly trích và thu nhận trực tiếp DNA vi khuẩn với kết quả rất tốt bằng phương pháp SDS.  Kết quả phân tích bằng phương pháp PCR, DGGE và giải trình tự vùng V3 đoạn 16S rDNA cho mẫu rơm trước xử lý (RT) gồm 9 phân đoạn: RT1, RT2, RT3.1, RT3.2, RT4, RT5, RT6, RT7.1, RT7.2 và mẫu rơm sau khi ủ hai ngày (R2) gồm 8 phân đoạn: R2.1.1, R2.1.2, R2.2, R2.3, R2.4, R2.5, R2.6, R2.7. Tuy nhiên một số phân đoạn như RT2, R2.3 và R2.4 không cho kết quả nên không hình thành cây phân loài cho các phân đoạn này.  Sau khi so sánh trên hệ thống Genebank và thiết lập cây phân loài với kết quả của các mẫu rơm có độ tương đồng di truyền như: Rơm trước xử lý (RT): - RT1 tương đồng 88% với Pseudomonas stutzeri và 87% với Azotobacter chroococcum. - RT3.1 tương đồng 85% với Pedobacter yonginense và 89% với Sphingobacterium bambusae. - RT3.2 tương đồng với Bacillus aryabhattai và Bacillus cereus đến 99%. - RT4 tương đồng với Bacillus pumilus và Candidatus Rhizobium massiliae đến 99%. - RT5 tương đồng với Pseudochrobactrum saccharolyticum và Ochrobactrum rhizosphaerae đến 99%. - RT6 tương đồng với Rhizobiales bacterium lut6 97% và Prosthecomicrobium pneumaticum là 94%. 61
  63. Đồ án tốt nghiệp - RT7.1 tương đồng 99% với cả hai loài Actinomycete T13 và Streptomyces toxytricini. - RT7.2 tương đồng 89% với cả hai loài Rhizobiales bacterium và Candidatus Riegeria galatelae. Rơm sau xử lý (R2): - R2.1.1 tương đồng 93% với cả hai loài Algibacter lectus và Flavobacteriaceae bacterium ACEMC 9-8. - R2.1.2 tương đồng 87% với loài Rikenellaceae bacterium. - R2.2 có độ tương đồng cao nhất là 100% với loài Leadbetterella byssophila, có thể đây chính là loài vi khuẩn có trong mẫu rơm sau khi ủ hai ngày. - R2.5 tương đồng 95% với Acinetobacter haemolyticus và 97% với loài Sphingomonas pituitosa. - Agrobacterium tumefaciens tương đồng 97% với cả hai chủng R2.6 và R2.7. 4.2 Đề Nghị Sau quá trình làm đồ án tốt nghiệp, vì thời gian còn hạn chế nên có nhiều phương pháp và quy trình mà đồ án vẫn chưa tiến hành thử nghiệm hết được, chúng tôi có một số đề nghị như sau:  Thử nghiệm các phương pháp tách chiết DNA tổng số nhằm so sánh và chọn ra phương pháp ly trích tối ưu nhất.  Thực hiện DGGE với các mẫu rơm ủ 4 ngày và rơm ủ 2 tuần, tiến hành thành lập cây phân loài vi khuẩn của cả hai mẫu rơm này và so sánh sự thay đổi hệ vi khuẩn trong các mẫu sau thời gian ủ khác nhau.  Nghiên cứu sản xuất chế phẩm chứa các chủng vi khuẩn phát triển trong các mẫu rơm tiền xử lý trước khi trồng nấm nhằm làm giảm thời gian trồng, nâng cao kinh tế của nông dân. 62
  64. Đồ án tốt nghiệp TÀI LIỆU THAM KHẢO TIẾNG VIỆT 1. Lê Đức Ngoan (2005). Giáo trình thức ăn gia súc, trường Đại học Nông Lâm Huế, Nhà xuất bản Nông nghiệp, Huế. 2. Lê Xuân Phương (2008). Giáo trình vi sinh vật học môi trường, Đại học Bách Khoa Đà nẵng. 3. Nguyễn Thanh Thủy, La Thị Phương, Đặng Thị Cẩm Hà (2004). Sử dụng phương pháp điện di gel gradient biến tính để xác định mức độ đa dạng của vi sinh vật trong các công thức thử nghiệm xử lý đất ô nhiễm chất độc hóa học, Tạp chí Công Nghệ Sinh Học, 2 (3), 381 – 388. 4. Phạm Thị Lan Thanh (2007). Luận Văn Thạc Sĩ Sinh Học: Phân Lập, Định Danh Nghiên Cứu Tiềm Năng Pribiotic Của Vi Khuẩn Lactobacillus Có Nguồn Gốc Từ Người, tủ sách Đại Học Khoa Học Tự Nhiên. TIẾNG ANH 5. Atsuo S. (2005). Succession of methanogenic archaea in rice straw incorporated into a Japanese rice field: eatimation by PCR – DGGE and sequence analyses, US National Library of Medicine National Institues of Health, 1 (6), 391 – 397. 6. Jara C. et al (2008). Analysis of several methods for the extraction of high quality DNA from acetic acid bacteria in wine and vinegar for characterization by PCR-based methods, International Journal of Food Microbiology, 128 (2), 336 – 341. 7. Ramos C., Schabereiter C., Denner E.B.M (2001). Detection of Indigenous Halobacillus Populations in Damaged Ancient Wall Paintings and Building Materials: Molecular Monitoring and Cultivation, Appl Environ Microbiol, 67(10), 4891 – 4895. 63
  65. Đồ án tốt nghiệp 8. Do Thi Xuan (2007). Functional and molecular diversity of rice straw decomposing bacteria and fungi, Faculty of Natural Resources and Agricultural Sciences (Ultuna), Germani. 9. Zhou J. et al (1996). DNA recovery from soils of diverse composition, Applied and Environmental Microbiology, 62 (2), 316 – 322. 10. Jia Xia, Han Shi-Jie, Zhao Young-hua, Zhou-Yu-mei (2006). Comparisions of extraction and purification methods of soil microorganism DNA from rhizoshere soil, Journal of Forestry research, 17(1), 31 – 34. 11. Juria R. (2004). Impact of DNA extraction method on bacterial community composition measured by denaturing gradient gel electrophoresis, Soil Biology & Biochemistry, 36 (10), 1607–1614. 12. Ha Guyn Sung (2007). Low Ruminal pH Reduces Dietary Fiber Digestion via Reduced Microbial Attachment, Association Animal Production Societies, 20 (2), 200 – 207. 13. Hong-Bum Cho1, Jong-Kwang Lee, and Yong-Keel Choi (2003). The Genetic Diversity Analysis of the Bacterial Community in Groundwater by Denaturing Gradient Gel Electrophoresis (DGGE), The Journal of Microbiology, 41 (4), 327 – 334. 14. Gavin P. Gafan, Victoria S. Lucas, Graham J.Roberts (2005). Statistical Analyses of Complex Denaturing Gradient Gel Electrophoresis Profile, Journal Clinical Microbiology, 41 (8), 3971 – 3978. 15. Ghazanfar S., Azim A., Ghazanfar M. A., Anijum M. I., Begum I (2010). Metagenomics and its application in soil microbial community studies: Biotechnological prospect. Journal of Animal & Plant sciences, 6 (2), 611 – 622. 16. Green, SJ, Leigh, MB and Neufeld, JD 2009. Denaturing gradient gel electrophoresis (DGGE) for microbial community analysis, KN (Ed) Handbook of Hydrocarbon and Lipid Microbiology, Germany, Pages 4137- 4158 in: Timmis. 64
  66. Đồ án tốt nghiệp 17. M. Antongiovanni and C. Sargentini. Variability in chemical composition of straws, Diparmento Di Scienze Zootecniche Universita Di Firenze Via Delle Cascine, 5 – 50144 Firenze, Italy. 18. Haruta S. (2002). Construction of a stable microbial community with high cellulose – degradation ability, Appl Microbiol Biotechnol, 59 (4), 529 – 534. 19. Sabine Weber et al. (2011). Bacterial Populations Colonizing and Degrading Rice Straw in Anoxic Paddy Soil, Applied and Environmental Microbiology, American Society for Microbiology, USA. 20. Tomoyukihori, Shin Haura, Yohiyuki Ueno, Masaharuishii, Yasuo Igarashi (2006). Direct comparinson of singlestand conformation polymorphism (SSCP) and denaturing gradient gel electrophoresis (DGGE) to characterize a microbial community on the basis of 16S RNA gene fragment, Journal of Microbiological Methods, 66, 165 – 169. 21. Zhu H, Qu F, Zhu LH. Isolation of genomic DNAs from plants, fungi and bacteria using benzyl chloride. NucleicAcids Res 1993; 21(22), 5279–80. INTERNET 22. dung-vi-sinh.516774.html 23. phantu.htm 24. 25. encing.pdf 65
  67. PHỤ LỤC Phụ lục A:Một số hình ảnh mẫu rơm được lấy làm thí nghiệm Rơm tươi Rơm ủ 2 ngày Rơm trồng n ấm 4 ngày Rơm trồng nấm 2 tuần 1
  68. Phụ lục B: Hình ảnh về thiết bị DGGE 2
  69. Phụ lục C: Kết quả trình tự vùng V3 đoạn 16S rDNA của các chủng vi khuẩn. 3