Đồ án Ứng dụng thử nghiệm công nghệ iRNA vào nghiên cứu chuyển đổi giới tính tôm càng xanh Macrobrachium rosenbergii

pdf 64 trang thiennha21 12/04/2022 50
Bạn đang xem 20 trang mẫu của tài liệu "Đồ án Ứng dụng thử nghiệm công nghệ iRNA vào nghiên cứu chuyển đổi giới tính tôm càng xanh Macrobrachium rosenbergii", để tải tài liệu gốc về máy bạn click vào nút DOWNLOAD ở trên

Tài liệu đính kèm:

  • pdfdo_an_ung_dung_thu_nghiem_cong_nghe_irna_vao_nghien_cuu_chuy.pdf

Nội dung text: Đồ án Ứng dụng thử nghiệm công nghệ iRNA vào nghiên cứu chuyển đổi giới tính tôm càng xanh Macrobrachium rosenbergii

  1. BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC KỸ THUẬT CÔNG NGHỆ TP. HCM ĐỒ ÁN TỐT NGHIỆP ỨNG DỤNG THỬ NGHIỆM CÔNG NGHỆ RNA INTERFERENCE VÀO NGHIÊN CỨU CHUYỂN ĐỔI GIỚI TÍNH TÔM CÀNG XANH Macrobrachium Rosenbergii (De Man, 1879) Ngành: CÔNG NGHỆ SINH HỌC Chuyên ngành: CÔNG NGHỆ SINH HỌC Sinh viên thực hiện : Nguyễn Thị An. Cán bộ hướng dẫn : Th.S Bùi Thị Liên Hà. MSSV: Lớp: 08DSH4
  2. TP. Hồ Chí Minh, 2012
  3. Đồ án tốt nghiệp CHƯƠNG 1. MỞ ĐẦU 1.1. Đặt vấn đề. Tôm càng xanh (Macrobrachium rosenbergii) (De Man, 1879) là loài tôm nước ngọt có giá trị quan trọng và đóng vai trò lớn trong nghề nuôi trồng thủy sản ở nhiều nước nhiệt đới và cận nhiệt đới. Trong những năm gần đây, việc nuôi tôm càng xanh ở Việt Nam đang phát triển một cách mạnh mẽ, đặc biệt là những khu vực nuôi tôm thương mại ở lưu vực sông Mê Kông đang mở rộng hơn 8000 ha và sản lượng đã đạt 10000 tấn trong năm 2010 (Hai, 2010). Do đó nhu cầu về con giống cho việc nuôi đại trà là rất lớn. Tuy nhiên, nghề nuôi tôm càng xanh đã và đang gặp nhiều khó khăn do những đặc điểm sinh học của chúng. Những con tôm càng xanh đực thường lớn nhanh gấp bốn hoặc năm lần tôm cái trong cùng quần thể và thời gian nuôi, điều này dẫn tới sự cạnh tranh về thức ăn, môi trường sống và gây ra hiện tượng ăn thịt đồng loại. Thông thường, sự khác nhau về kích thước của tôm có thể thấy bằng mắt trong giai đoạn trưởng thành về giới tính, con cái ngưng phát triển và tập trung dưỡng chất cho việc sinh sản (Cohen, 1984), trong khi đó con đực vẫn tiếp tục phát triển và đạt kích thước lớn hơn so với con cái khi trưởng thành. Những vấn đề này ảnh hưởng tới sản lượng thu hoạch và lợi ích kinh tế do kích thước tôm càng lớn thì giá thành càng cao. Việc nuôi tôm càng xanh toàn đực đạt sản lượng cao hơn việc nuôi toàn cái hay đực và cái trong cùng quần thể (Sagi và Ra’anan, 1988). Khối lượng trung bình của mỗi quần thể lần lượt là 473 g/m2, 248 g/m2 và 260 g/m2. Những nhà khoa học Ả Rập Xê Út cũng đã báo cáo những kết quả tương tự khi tiến hành thí nghiệm nuôi tôm toàn đực, toàn cái và hỗn hợp cả đực và cái (Siddiqui, 1997). Điều này thể hiện rằng việc nuôi tôm càng xanh toàn đực đã làm tăng sản lượng một cách đáng kể và mang lại lợi nhuận cao hơn việc nuôi toàn cái hay hỗn hợp đực và cái. Vì thế, việc nghiên cứu và phát triển một số kỹ thuật tạo quần thể tôm càng xanh toàn đực là nhu cầu cần thiết hiện nay. 1
  4. Đồ án tốt nghiệp Kỹ thuật bất hoạt RNA (Guo và Kempheus, 1995) đã được sử dụng như một công cụ hiệu quả để hiểu rõ về chức năng của những gene quy định tính trạng bằng cách tiêm RNA mạch đôi vào trong cơ thể của giáp xác (Tiu, 2007; Hiu, 2008). Ý tưởng tạo ra con cái giả bằng cách làm bất hoạt RNA thông tin mã hóa gene tuyến đực insuline–like của tôm càng xanh (Macrobrachium rosenbergii insulin–like androgeneic gland, Mr–IAG) bằng RNA mạch đôi (dsRNA) đã được thực hiện thành công tại quy mô phòng thí nghiệm (Ventura và ctv, 2009). Kể từ đó, kỹ thuật bất hoạt RNA hứa hẹn như là một hướng tiếp cận mới để tạo ra quần thể tôm toàn đực cho việc nuôi tôm càng xanh thương mại. Chính vì những lý do đó mà đề tài “Ứng dụng thử nghiệm công nghệ iRNA vào nghiên cứu chuyển đổi giới tính tôm càng xanh Macrobrachium rosenbergii” được tiến hành. 1.2. Mục đích của đề tài. Mục đích của việc nghiên cứu này là ứng dụng kỹ thuật bất hoạt RNA để tạo ra con cái giả phục vụ cho công tác tạo tôm càng xanh toàn đực với Mr–IAG là gene mục tiêu. 1.3. Nội dung của đề tài. Nghiên cứu công nghệ bất hoạt RNA thông qua quy trình tổng hợp double stranded RNA theo bộ Kit của hãng Promega và Ambion. Kiểm tra hiệu quả của sợi đôi dsRNA trong thực nghiệm chuyển đổi giới tính của tôm càng xanh Macrobrachium rosenbergii. 2
  5. Đồ án tốt nghiệp CHƯƠNG 2. TỔNG QUAN 2.1. Tổng quan về tuyến đực trên tôm càng xanh Macrobrachium rosenbergii. 2.1.1. Phụ bộ đực. Phụ bộ đực là cơ quan giao cấu ở tôm càng xanh đực nó xuất hiện ở chân bơi thứ hai. Chồi của phụ bộ đực bắt đầu xuất hiện vào giai đoạn khoảng 70 ngày tuổi sau giai đoạn postlarve (trọng lượng 0,38g; tổng chiều dài 3,7 cm) đến giai đoạn 94 ngày tuổi thì phụ bộ đực phát triển đầy đủ (Chung Quang Trí, 2006). Hình 2.1. Chân bơi thứ 2 của tôm càng xanh đực. 2.1.2. Tuyến đực. Những tế bào thuộc tuyến đực được quan sát đầu tiên bởi Faxon (1884) trong tôm nước ngọt Cambarus montanus (Faxon, 1884). Tuyến hormon đã được xác định sau đó ở giáp xác Orchestia gammarellus vào 1953 và mô đó được gọi là tuyến đực (Charniaux–Cotton, 1953). Những nghiên cứu sau này đã cho thấy rõ hơn về tuyến đực, nó là một lớp mô mỏng gắn ở phần cuối ống dẫn tinh của tôm nước ngọt Procambarus blandingii, P. viaeviridis, Camb. bartonni và Camb. diogenes (Puckett, 1964). Những cấu trúc tương tự cũng đã được quan sát ở cua Scylla serrata (King, 1964). Ở giáp xác tinh sào là nơi tạo tinh trùng còn cơ quan tạo hormon là tuyến đực. Nếu ở con đực động vật có xương sống, tuyến sinh dục (tinh sào) có hai chức năng căn bản là tạo tinh trùng và nội tiết như testosterone thì ở tôm càng xanh và có thể ở nhiều động vật giáp xác thuộc bộ mười chân Decapoda khác hai chức năng 3
  6. Đồ án tốt nghiệp này thực hiện bởi hai cơ quan riêng lẻ. Tinh sào ở tôm càng xanh chuyên tạo tinh, còn tuyến đực (androgenic gland) – một cơ quan biệt lập khác có chức năng tiết ra hormon, tham gia vào sự biệt hoá giới tính và phát triển những đặc điểm sinh dục thứ cấp, ảnh hưởng lên kích thước và sự tăng trưởng (Sagi, 2001). Ở những tôm đực lớn người ta có thể thấy được tuyến đực tương đối rõ. Đó là một khối tế bào có hình kim tự tháp, dính với phần sau ống phóng tinh. Cũng như tuyến sinh dục và ống dẫn tinh, tuyến đực chịu sự ức chế của một tuyến nội tiết nằm ở cuống mắt tôm. Hình 2.2. Tuyến đực ở tôm càng xanh có hình kim tự tháp ở cuối ống dẫn tinh. Sự tồn tại của tuyến đực được xác nhận ở nhiều loài giáp xác, chúng tiết ra hormon có tác động lên sự biệt hoá giới tính (Chaniaux–Cotton và Payen, 1985; Katakura, 1989). Tuyến AG có vai trò lên sự biệt hóa giới tính và quá trình lột xác. Charniaux– Cotton đã chứng minh rằng việc cắt bỏ tuyến AG ở Orchestia gammarella làm giảm sự sinh tinh trùng ở con đực (Charniaux–Cotton, 1954). 2.1.3. Hormon tuyến đực. Hormon tuyến đực tinh chế đã được tìm ra trên nhóm giáp xác chân đều Armadilidium vulgare là một protein gồm có ba chuỗi peptid A (chứa 29aa), B (44aa), và C (45aa), ngoài ra trên chuỗi A ở aa thứ 18 còn có thêm một nhóm carboxyl (Martin và ctv, 1999). Trọng lượng phân tử hormon khoảng 16.570 Da. Khi tiến hành tiêm hormon tuyến đực cho con cái còn nhỏ, sau này con cái này phát triển thành con đực, khi cho giao vĩ với con cái thì có chức năng sinh sản cho ra thế hệ con. 4
  7. Đồ án tốt nghiệp Hình 2.3. Cấu trúc phân tử hormon tuyến đực (Martin và ctv, 1999). 2.1.4. Tác động của tuyến đực lên sự phân hóa giới tính ở tôm càng xanh. Tuyến androgenic (AG) là cơ quan nội tiết của con đực, có vai trò quan trọng trong việc hình thành giới tính và các đặc tính sinh dục thứ cấp (Ohs và ctv, 2006). AG nằm cuối ống dẫn tinh, gần lỗ mở sinh dục và liên kết lõng lẻo với ống dẫn tinh. AGH là hormon điều khiển biệt hóa giới tính thành con đực và phát triển các đặc điểm sinh dục đực thứ cấp. Sự tiết GSH và GIH được cho là do quy định của một số chất dẫn truyền thần kinh và tác động trực tiếp vào buồng trứng của con cái. Ở con đực, GIH tác động lên tinh hoàn gián tiếp bởi sự điều khiển AG và sau đó giảm tiết AGH. Hormon kích thích tuyến sinh dục là cần thiết để có sự sinh tinh xảy ra trong tinh hoàn (Fingerman, 1997). AG tham gia vào quá trình biệt hóa giới tính ở con đực thông qua việc tiết hormon. AGH là tín hiệu ban đầu của tất cả các bước cần thiết trong quá trình biệt hóa giới tính và phát triển đặc điểm của con đực (Ohs và ctv, 2006). Nếu không có AG hoặc sự tiết AGH không đủ thì tuyến sinh dục sẽ biệt hóa thành tuyến sinh dục cái (Sagi và ctv, 1995). Sự phát triển của AG được cho là dấu hiệu của tín hiệu di truyền (Ohs và ctv, 2006). Sự cắt bỏ tuyến androgenic ở tôm càng xanh Macrobrachium rosenbergii giai đoạn còn non có thể gây đảo giới hoàn toàn, với sự cái hóa các tính trạng sinh dục sơ cấp và thứ cấp và con vật có thể sinh sản như con cái (Sagi và ctv, 1990; Sagi và ctv, 1997). 5
  8. Đồ án tốt nghiệp 2.2. Công nghệ chuyển đổi giới tính tôm càng xanh. 2.2.1. Cơ sở lý thuyết tạo dòng tôm càng xanh toàn đực. Cặp nhiễm sắc thể giới tính ở tôm càng xanh đực là đồng giao tử (ZZ) và con cái là dị giao tử (WZ). Để tạo dòng đơn tính toàn đực (100% tôm đực ZZ) thì cần có tôm bố và tôm mẹ có cùng NST ZZ. Để tạo dòng toàn đực việc cần thiết để tạo tôm cái giả mang NST ZZ. Male: ♂ (ZZ) X Female: ♀ (ZZ) 100% ♂ (ZZ) Hình 2.4. Sơ đồ tạo dòng đơn tính đực. Sagi và Cohen đã cho biết khi cho những con cái chuyển giới khoẻ mạnh khi lai với con đực thông thường sẽ cho ra một dòng con toàn đực (Sagi, Cohen, 1990). 2.2.2. Các phương pháp tạo tôm càng xanh cái giả. 2.2.2.1. Vi phẩu loại bỏ tuyến đực. Tôm chưa trưởng thành có thể thực hiện vi phẫu loại bỏ tuyến androgene ở tôm đực, dẫn đến sự tạo trứng, sự phát triển của vòi trứng và lỗ sinh sản của con cái trong con đực đã chuyển giới trong giai đoạn phát triển còn non nhất. Tôm đực sau đó sẽ phát triển thành con cái. (Nagamine và ctv, 1980). Việc loại bỏ AG ở con đực, làm mất AGH gây nên hiện tượng: con đực thành con cái mang NST ZZ. Kỹ thuật vi phẫu loại bỏ tuyến androgenic được thực hiện lần đầu tiên bởi Sagi (Sagi và ctv, 1990). Ở Việt Nam, kỹ thuật vi phẫu đã được thực hiện và thành công năm 2004 (Nguyễn Văn Hảo và ctv, 2004). Kỹ thuật vi phẫu là kỹ thuật tạo ra tôm cái giả để sản xuất tôm toàn đực phổ biến hiện nay. Tuy nhiên kỹ thuật này cần có kỹ thuật viên có tay nghề cao, cần nhiều người để sản xuất một số lượng tôm cái giả lớn, chi phí sản xuất lớn, tỷ lệ tôm vi phẫu thành tôm cái giả có thể sinh sản được thì không ổn định. Vì vậy, cần tìm ra các phương pháp mới để cải thiện các hạn chế của kỹ thuật vi phẫu nhằm tạo nguồn tôm toàn đực để tăng sản lượng cho người nuôi. 6
  9. Đồ án tốt nghiệp 2.2.2.2. Cấy tuyến đực vào tôm cái. Sự biệt hóa giới tính ngược của con cái isopod Armadillidium vulgare, được gây ra do việc cấy AG vào trong con cái, sau đó đã bắt đầu biệt hóa hình thái giới tính. Ở tôm càng xanh, việc cấy AG của con đực trưởng thành vào trong con cái chưa trưởng thành, kết quả là con cái đã biệt hóa ngược thành con đực (Nagamine và ctv, 1980). Tuy nhiên, khả năng sống sau khi cấy AG thấp (Ohs và ctv, 2006). 2.2.2.3. Sử dụng hormon. Hiện nay, steroid được sử dụng để thay đổi kiểu hình giới tính cá khi ngâm hoặc tiêm hoặc qua chế độ ăn trước khi biệt hóa giới tính. Điều này mang lại hy vọng trong việc sử dụng hormon để điều khiển giới tính ở động vật giáp xác. Điều khiển chế độ ăn chứa hormon được xem là phương pháp thiết thực nhất trong quy mô thương mại. Tuy nhiên, phương pháp này mang lại những thách thức do khả năng mất các hormon do sự rò rỉ từ các viên thức ăn hoặc từ sự cố tiêu hóa, đặc biệt là mất do sự thay đổi của thức ăn chế biến trước khi tiêu thụ (Ohs và ctv, 2006). Dewi và cộng sự đã dùng hormon 17β–estradiol bổ sung vào thức ăn để điều khiển giới tính tôm càng xanh. Kết quả thu được là 17β–estradiol không ảnh hưởng đến tỷ lệ đực cái ở tôm càng xanh (Dewi và ctv, 2006). Baghel và cộng sự đã nghiên cứu ảnh hưởng chuyển đổi giới tính khi cho ấu trùng tôm càng xanh ăn artemia đã làm giàu với 17α–methyltestosterone, dạng steroid của động vật có xương sống, kết quả cho thấy 17α–methyltestosterone có tác dụng chuyển đổi giới tính của tôm càng xanh từ cái thành đực (Baghel và ctv, 2004). Nhưng sau đó, Ohs và cộng sự dùng 17α–methyltestosteron bổ sung vào thức ăn để chuyển giới tính tôm càng xanh. Tuy nhiên, kết quả lại cho thấy 17α– methyltestosteron không có tác dụng trong việc chuyển đổi giới tính tôm càng xanh (Ohs và ctv, 2006). Như vậy, 17α–methyltestosterone có tác dụng chuyển đổi giới tính ở tôm càng xanh là chưa xác định. Ohs và cộng sự cho hậu ấu trùng của tôm càng xanh thường (50% đực, 50% cái) ăn thức ăn có bổ sung dopamine với 3 nồng độ 0,15; 1,5; và 15 ppm trong vòng 60 ngày (Ohs và ctv, 2006). Kết quả ở nhóm đối chứng có tỷ lệ tôm cái là 62,6%, 7
  10. Đồ án tốt nghiệp trong khi đó 3 nghiệm thức cho tôm ăn thức ăn bổ sung dopamine với nồng độ 0,15; 1,5 và 15 mg/kg có tỷ lệ tôm cái lần lượt là: 80,9%; 88%; và 71%. Kết quả cho thấy có sự chênh lệch đáng kể giữa nhóm không và có cho ăn thức ăn có bổ sung dopamine. Thử nghiệm đã tạo ra một tiềm năng sử dụng dopamine để tạo ra tôm càng xanh toàn đực phục vụ cho sản xuất. 2.3. Giới thiệu cộng nghệ iRNA và ứng dụng trong tạo tôm càng xanh cái giả. 2.3.1. Giới thiệu về iRNA. Công nghệ iRNA gây bất hoạt gene là một công cụ đầy hứa hẹn và là cơ chế điều khiển hoạt hóa gene phổ biến ở các cơ thể sống nhân thực. iRNA là quá trình làm bất hoạt gene một cách đặc thù, nó chỉ làm bất hoạt một gene (gene đích) có trình tự tương đồng với các tác nhân gây bất hoạt gene (các sợi RNA ngắn khoảng 21–27 nucleotide). iRNA có thể tham gia điều khiển hoạt hóa gene ở giai đoạn phiên mã gene – ngăn cản sinh tổng hợp RNA hoặc ở giai đoạn sau phiên mã – phân hủy mRNA và làm triệt tiêu sinh tổng hợp protein (Đỗ Năng Vịnh, 2007). Can thiệp RNA (iRNA) là sợi đôi RNA (dsRNA), nó có tác động đặc hiệu với một trình tự mục tiêu, thúc đẩy sự phân hủy và ngăn chặn sự biểu hiện của trình tự mục tiêu (Chen và ctv, 2003). Sự can thiệp RNA thông qua trung gian dsRNA là một cơ chế bất hoạt gene sau phiên mã (PTGS) và bảo tồn trong suốt quá trình phát triển. Nó cũng có thể biểu hiện ở mức độ phiên mã hoặc dịch mã của quá trình sao chép nội sinh và ở mức nhiễm sắc bằng cách hình thành vùng chất nhiễm sắc thể trong nhân (Hannon, 2002). iRNA là một hiện tượng trong Neurospora crassa, trình tự RNA tương đồng có khả năng chế ngự gene nội sinh (Romano và Macino, 1992). Dựa trên thành tựu của chương trình Geneomics trình tự của hầu hết các gene quan trọng đều có thể xác định, từ đó thiết kế các dsRNA tương đồng để gây bất hoạt mọi gene đích. Công nghệ iRNA có thể tạo ra cuộc cách mạng trong nghiên cứu y sinh và chữa bệnh. Ý nghĩa khoa học và tiềm năng ứng dụng to lớn của công nghệ iRNA đã được nhiều tác giả đề cập, họ cho đây là “một công nghệ đầy uy lực”, “cuộc cách mạng iRNA” (Archana, 2003; Ajit, 2007). Năm 1998, hai nhà 8
  11. Đồ án tốt nghiệp khoa học Mỹ Fire và Mello đã xuất bản công trình nghiên cứu đột phá về cơ chế gây bất hoạt gene bởi iRNA đăng trên tạp chí Nature (Fire và Mello, 1998). 2.3.2. Lịch sử nghiên cứu iRNA. Trong lịch sử, sự can thiệp RNA hay iRNA được biết đến với những tên gọi khác như : RNA silencing, quelling, cosuppresion, RNA inteference . . . Lần đầu tiên, các nhà nghiên cứu nhận thấy rằng RNA sense có hiệu quả cũng như là RNA antisense trong việc ức chế sự biểu hiện gene ở loài giun với tên khoa học là C. elegans (Guo và Kemphues, 1995). Nghiên cứu iRNA được mô tả là một hiện tượng trong C.elegans, bằng cách tiêm dsRNA vào trong C. elegans đã dẫn đến sự bất hoạt trình tự gene đặc hiệu và tạo ra thuật ngữ “iRNA – Can thiệp RNA” (Fire và ctv, 1998). Nghiên cứu quá trình bất hoạt gene hậu phiên mã (PTGS) ở thực vật được báo cáo bởi Hamilton và Baulcombe (Hamilton và Baulcombe, 1999). Phát hiện hiện tượng PTGS ở cây trồng và khả năng kháng virus được gây ra bởi dsRNA. Hiện tượng bất hoạt gene sau dịch mã trong cây có tương quan với phân tử RNA nhỏ (mỗi phân tử có chiều dài khoảng 21–25 nucleotide). Trong quần thể các phân tử RNA nhỏ có cả các trình tự sense RNA và antisense RNA (Hamilton và Baucombe, 1999). Quá trình xử lý dsRNA mạch dài thành những đoạn ngắn 21–23 nucleotide là nhờ enzyme Dicer RNase III ở ruồi giấm Drosophila (Zamore và ctv, 2000). Lần đầu tiên mô tả iRNA trên tế bào động vật có vú (Tuschl và ctv, 2001). Nghiên cứu những đoạn RNA ngắn có cấu trúc kẹp tóc (shRNAs) là nguyên nhân gây ra sự bất hoạt trình tự đặc hiệu ở những tế bào động vật có vú (Paddison và ctv, 2003; Sui và ctv, 2003; Paul và ctv, 2003). Bài báo cáo đầu tiên cho rằng những đoạn iRNA nhỏ được sử dụng trong chữa bệnh ở động vật có vú (Song và ctv, 2003). Những đoạn iRNA nhỏ có khả năng bất hoạt gene ở mức độ phiên mã thông qua methyl hóa DNA de novo ở người (Kawasaki, Taira và ctv, 2004). 9
  12. Đồ án tốt nghiệp iRNA kiểm soát hoạt hóa gene ở giai đoạn phiên mã (TGS – transcriptional gene silencing), các phân tử siRNA ngăn cản phiên mã khống chế số lượng phân tử mRNA. Cơ chế này xảy ra trong nhân tế bào và mục tiêu tác động là DNA (Matzke và ctv, 2004; Huettel và ctv, 2007). Ở tế bào sinh vật nhân thực, iRNA là một bộ máy sinh hóa quan trọng đóng vai trò điều hòa hoạt hóa gene và bảo vệ cơ thể (Hannon, 2002; Mello và ctv, 2004; Meister và Tuschl, 2004; Hammond, 2005). Giải thưởng Nobel trong sinh học và y học trong việc khám phá cơ chế iRNA (Andrew Fire và Craig Mello, 2006). Nghiên cứu những đoạn dsRNA nhỏ tạo ra sự hoạt hóa gene phiên mã “hoạt hóa RNA” (Li và ctv, 2006). Chứng minh được siRNA giúp con người có thể sản xuất một gene đặc hiệu làm giảm lượng mRNA và protein nhờ cơ chế hoạt động của iRNA (Davis và cộng sự, 2010). 2.3.3. Cơ chế bất hoạt gene của iRNA. Nghiên cứu hóa sinh iRNA ở ruồi giấm cho thấy RNA sợi kép (dsRNA) đã được phân cắt thành các đoạn dsRNA ngắn gồm 21–23 nucleotide (Tuschl và ctv, 1999). Họ cho rằng các phân tử dsRNA ngắn (siRNA–small interfering RNA) đóng vai trò phân hủy mRNA. Sau đó, nhóm Fire và Mello; Parrish và cộng sự đã xác minh rằng dsRNA dài đã được cắt thành đoạn RNA ngắn khoảng 25 nucleotide và tiếp theo siRNA gây ra sự phân hủy mRNA thông qua việc bắt cặp với mRNA (Fire, Mello và ctv, 2000).  Cơ chế bất hoạt gene được mô tả như sau: RNA sợi kép (dsRNA) bị cắt thành những mảnh nhỏ (siRNA) bởi một endonuclease gọi dicer. Sau đó, sợi kép ngắn lại được mở xoắn để tạo ra 2 sợi đơn ngắn và 1 trong 2 sợi đó là sợi antisense (sợi đối nghĩa). Sợi antisense ngắn (siRNA) được nạp vào phức hợp RISC. Sau đó, phức hợp RISC có gắn antisense RNA này bắt cặp với mRNA bằng liên kết tương đồng giữ các base. Phần dư ra của sợi mRNA sẽ bị RISC phân cắt. Điều này có nghĩa sợi mRNA thông tin bị phân hủy 10
  13. Đồ án tốt nghiệp và kết quả là protein được dịch mã từ mRNA này không được tổng hợp. Quá trình dịch mã gene bị bất hoạt. Hình 2.5. Cơ chế hoạt động của iRNA [68]. A. Trong tế bào, quá trình sao chép nội sinh và ngoại sinh mở đầu cho hoạt động của những sợi dsRNA dài, chúng được xem như là một chất kích hoạt quá trình can thiệp RNA (iRNA). B. Đây là quá trình đầu tiên mà dsRNA được xử lý dưới tác dụng của enzyme RNase III và ATP. C. dsRNA dài bị cắt thành những đoạn siRNA có kích thước 21–23 nucleotide với 2 nucleotide nhô ra ở đầu 3’. siRNA cũng có thể được tổng hợp bên 11
  14. Đồ án tốt nghiệp ngoài tế bào và sau đó được đưa vào trong tế bào nhờ quá trình lây nhiễm hoặc xung điện. D. siRNA kết hợp với phức hợp phản ứng lại kích thích iRNA (RISC). Phức hợp này chứa thành phần chính là Agronaute (Argo), Ago gắn vào siRNA, tách và loại bỏ sợi sense của siRNA để RISC hoạt động. E và F. Còn lại là sợi antisense của siRNA mạch kép, được xem là sợi chỉ dẫn, hướng dẫn RISC bám vào và bắt cặp với mRNA có trình tự tương đồng với nó, phân hủy mRNA đích. Kết quả là không có mRNA cho quá trình giải mã tổng hợp protein hay hormon của gene đó. 2.3.4. Vai trò của iRNA. iRNA kìm hãm tổng hợp protein và điều hòa sự phát triển của cơ thể sinh vật. Hiện nay đã phát hiện khoảng 500 gene ở người và động vật có vú tổng hợp khoảng 500 phân tử miRNA khác nhau có chiều dài khoảng 21 nucleotide và khoảng 30% tổng số gene được điều khiển bởi các phân tử miRNA (Ajit, 2007). iRNA là cơ chế bảo vệ cơ thể khỏi sự xâm nhiễm của virus. Các công trình nghiên cứu công bố năm 1997 cho thấy cây trồng có hàng rào bảo vệ hiệu quả chống lại sự xâm nhiễm của virus dựa trên cơ chế PTGS (Covey và ctv, 1997; Ratcliff và ctv, 1997). Bộ máy dsRNA có thể nhận biết được RNA của virus xâm nhập và ngăn chặn RNA virus bằng cách phân hủy RNA virus, nhận biết sự xâm nhập của sinh vật ký sinh, tạo ra các phản ứng gây bất hoạt gene ban đầu và sau đó khuếch đại phản ứng để loại bỏ hoàn toàn các nhân tố bên ngoài xâm nhập. iRNA bảo đảm sự bền vững của genome thông qua sự bất hoạt gene nhảy (Fire, Melo và ctv, 1998). Các gene nhảy gây ra rất nhiều các đột biến bất lợi trong cơ thể sống. Trong vùng chứa gene nhảy của genome, cả hai sợi DNA được sao chép, dsRNA được tạo thành và dẫn đến quá trình iRNA loại bỏ những sản phẩm không mong muốn từ gene nhảy. Những phần tử dsRNA ngắn tác động trực tiếp lên sợi nhiễm sắc và ngăn chặn sự dịch mã (Tabara và ctv, 1999). Cơ chế bất hoạt gene iRNA tạo nên hệ thống miễn dịch của genome (Plasterk, 2002). 12
  15. Đồ án tốt nghiệp 2.3.5. Các nghiên cứu ứng dụng của iRNA trong nuôi trồng thủy sản. Can thiệp RNA (iRNA) là một hiện tượng bất hoạt đặc hiệu của gene trong các sinh vật đa bào gồm Drodophia, Caenorhabditis elegans, động vật có vú và ký sinh Công nghệ iRNA là một phương pháp nghiên cứu hiệu quả về chức năng gene trên động vật thủy sản, điển hình trên cá ngựa vằn Danio rerio, [71] iRNA đã được nghiên cứu trên luân trùng Brachionus plicatilis nhằm tăng cường khả năng đánh giá những tính năng di truyền đặc biệt quan trọng ảnh hưởng đến vòng đời của chúng (Snell và ctv, 2010). Cơ chế của iRNA là làm bất hoạt gene sau phiên mã, chức năng này của nó trong tự nhiên chịu trách nhiệm chống lại sự nhiễm trùng virus ở đa số loài. Kết quả là làm bất hoạt gene của Dicer–1 của virus trong tôm sú (Penaeus mondon) làm tăng tỷ lệ chết của virus, cơ chế iRNA hoạt động mạnh mẽ và có chức năng miễn dịch tốt trên tôm (Su, Oanh, Lyons và ctv, 2008). Mức cao hơn là các Dicer ở tế bào bạch cầu nó đóng vai trò làm miễn dịch tự nhiên ở trong tôm (Zhang, Song, Zhao và ctv, 2010). Ở tôm thẻ chân trắng (Litopenaeus vannamei) Dicer–2 bao gồm miễn dịch không đặc hiệu chống lại virus (Chen, Jia, Zhao và ctv, 2011). Dicer–2 góp phần vào chức năng miễn dịch không đặc hiệu ở tôm bằng cách nâng cao hiệu lực của iRNA (Kim, Behlke và ctv, 2005). Ứng dụng siRNA trong nghiên cứu ức chế TFV (tiger frog virus) trong tế bào cá, cung cấp tiềm năng trong điều trị bệnh do virus trong nuôi trồng thủy sản (Junfeng Xie và ctv, 2004). iRNA còn được nghiên cứu để bất hoạt gene của virus gây bệnh đốm trắng (WSD–white spot disease) ở tôm biển (Krishn và ctv, 2009). iRNA đặc hiệu (21bp) được ứng dụng để ức chế gene mã hóa protein vỏ (VP28) của virus WSSV trong cơ thể tôm Penaeus japonicas. Làm bất hoạt gene đích và có hiệu lực cao, miễn dịch đặc hiệu chống lại virus đốm trắng (WSSV) hoặc virus Taura ở tôm thẻ chân trắng Thái Bình Dương (Penaeus vannamei) bằng cách tiêm dsRNAs sợi dài có trình tự mã hóa cấu trúc protein của virus. Sử dụng dsRNAs tác động vào gene mục tiêu của virus đầu vàng 13
  16. Đồ án tốt nghiệp (YHV) sẽ thu được hiệu quả miễn dịch đặc hiệu giống như ở virus trên tôm sú Penaeus monodon (Vincent, Breland và Lotz, 2004). dsRNA can thiệp gián tiếp vào hầu hết các quá trình phiên mã gene, làm bất hoạt gene. Chức năng của gene có thể được nghiên cứu trong các sinh vật dưới nước bằng cách sử dụng iRNA. Kỹ thuật iRNA đã được ứng dụng trong 2 sinh vật ở dưới nước: cá ngựa vằn (Danio rerio) và tôm thẻ chân trắng (Litopenaeus schimitti) Đại Tây Dương. Kết quả đã chứng minh iRNA được sử dụng như là công cụ để nghiên cứu chức năng sinh học của các gene có liên quan đến sự phát triển của cá ngựa vằn Danio rerio. Các nghiên cứu gần đây đã chứng minh tính hữu ích của dsRNA trong cơ thể tôm trưởng thành. Hơn nữa, khả năng dsRNA ức chế chức năng của hormon hyperglycemic (CHH) trong tôm Đại Tây Dương cũng đã được nghiên cứu (Estrada và ctv, 2007). Ảnh hưởng iRNA trong tôm được giải thích bằng các thí nghiệm in vivo bằng cách tiêm dsRNA có trình tự tương đồng với gene mã hóa gonad inhibiting hormon (GIH) trong tôm cát Metapenaeus ensis. dsRNA làm giảm sự biểu hiện của GIH (Guan, Mark, Chan và ctv, 2004). Công nghệ iRNA đã được nghiên cứu trên động vật thân mềm hai mảnh, nó quyết định chức năng của gene ở sò Crassostrea gigas. Việc tiêm dsRNA tương ứng với gene Oyster vasa–like gene (Oyvlg) vào trong tuyến sinh dục sẽ làm ức chế quá trình giảm phân và làm bất hoạt sự sản sinh các tế bào phôi ở sò Crassostrea gigas (Fabioux và ctv, 2009). iRNA có ảnh hưởng đến các yếu tố tạo cơ ở các tua khác nhau trên loài bạch tuộc Sepia oficinalis (Grimaldi và ctv, 2004). Nghiên cứu tiêm dsRNA vào tôm Macrobrachium rosenbergii ngăn cản sự phát triển đặc điểm sinh dục thứ phát “gai phụ sinh dục đực” và giảm thông số tăng trưởng vốn thể hiện mạnh ở con đực (Ventura, 2009). 14
  17. Đồ án tốt nghiệp 2.3.6. Phương pháp chuyển dsRNA, shRNA, siRNA vào trong tế bào. 2.3.6.1. Phương pháp chuyển không cần virus. Phương pháp này sử dụng những siRNA bình thường và siRNA biến đổi bằng phương pháp hóa học, được sao chép trong môi trường in vitro. siRNA, shRNA, dsRNA được biểu hiện bởi plasmid đóng vai trò là vector. Chuyển bằng cách sử dụng liposome, lipid, protein–antibody, peptide Các cách trên được phân ra thành hai dạng: hệ thống và cục bộ (Aigner, 2007). Những phương pháp chuyển cục bộ chỉ cần một lượng nhỏ siRNA để tránh việc chuyển nhầm đến những bộ phận khác và giảm thất thoát do sự bài tiết của thận. Phương pháp chuyển hệ thống có thể thực hiện nhiều cách như gắn siRNA vào liposome, lipoplexe, và cationic lipid, tiêm siRNA, xung điện (Aigner, 2007). Cũng có thể chuyển siRNA hay dsRNA vào vật chủ bằng phương pháp ngâm như trứng của loài Drosophila melanogaster hấp thu được siRNA/dsRNA trong những giai đoạn phát triển sớm (Tabara và ctv, 1998; Timmons và ctv, 1998). 2.3.6.2. Phương pháp chuyển bằng plasmid. Chuyển shRNA hay siRNA vào trong plasmid, khi đó, plasmid này sẽ mã hóa shRNA, siRNA với hai mạch sense và antisense riêng biệt, có thể biểu hiện dưới sự kiểm soát của promoter được chọn. Promoter có thể là RNA polymerase II (pol–II)–dependent hay RNA polymerase III (pol–III)–dependent. U6 là Pol–III promoter được biểu hiện trong hầu hết các tế bào. Quá trình sao chép của nó bắt đầu tại chính xác một điểm và kết thúc tại nucleotide uredine. Một chuỗi nhiều hơn bốn thymidine cũng có thể được xem như là điểm kết thúc. Việc này rất có lợi trong việc biểu hiện những đoạn gene ngắn như shRNA nhằm tránh những nucleotide không mong muốn tại điểm kết thúc. Pol–II promoter có nhiều ưu điểm trong việc biểu hiện shRNA. Những promoter này có thuận lợi trong việc điều chỉnh sự bất hoạt RNA một cách nhất thời, tùy thuộc vào tính chất của chúng. Những promoter hoạt hóa như tetracycline 15
  18. Đồ án tốt nghiệp promoter và metallothionine promoter được sử dụng để hoạt hóa và kiểm soát quá trình iRNA nhưng những sản phẩm của pol–II promoter không kết thúc tại vị trí chính xác. Vì vậy, những mạch sao chép sẽ có nhiều nucleotide dư thừa tại điểm kết thúc. Chúng có thể can thiệp vào quá trình hoạt hóa đoạn RNA đích. Những đoạn dư thừa này có thể làm cho quá trình iRNA không nhận biết được đoạn gene mục tiêu. Do tác dụng phụ gây độc khi siRNA/shRNA bị biểu hiện quá mức nên promoter phải được lựa chọn cẩn thận dựa vào chiều dài của chúng để tránh tác dụng gây độc. Peng và cộng sự đã phát triển một hệ thống kết hợp những thuận lợi của của hai phương pháp trên (sự chính xác của của T7 RNA polymerase và điều chỉnh sự biểu hiện bằng pol–II promoter). Họ tạo ra một plasmid cấu trúc có thể biểu hiện shRNA bằng T7–RNA polymerase promoter và pol–II promoter kiểm soát sự biểu hiện của T7–RNA polymerase, nên T7 RNA polymerase có thể được điều chỉnh bởi pol–II promoter. Kết quả là shRNA được chỉnh sửa biểu hiện trong tế bào. Một trong những nhược điểm của quá trình này là hiệu quả của phương pháp chuyển có sự khác biệt giữa những tế bào và các điều kiện thí nghiệm khác nhau (Singh và ctv, 2009). Quá trình iRNA có thể thực hiện bằng cách chuyển dsRNAs vào vi khuẩn. Vi khuẩn có thể biểu hiện dsRNA dưới sự kiểm soát của T7 RNA polymerase promoter. Khi tế bào chủ hay sinh vật hấp thụ chúng, dsRNA được biểu hiện trong vi khuẩn có thể kích hoạt quá trình iRNA trong từng tế bào chủ hay sinh vật tương ứng (Singh và ctv, 2009). 2.3.6.3. Phương pháp chuyển nhờ virus. Thế mạnh của việc chuyển siRNA/shRNA bằng virus là có thể chuyển vào những tế bào mà khó bị nhiễm bởi những phương pháp khác và ngay cả những tế bào không phân chia. Vector của virus tải nạp vào tế bào một cách tự nhiên và hiệu quả cao hơn so với cảm nhiễm hay bất kì những cách chuyển không dùng virus. Những virus vector được sử dụng phổ biến nhất để chuyển shRNA bao gồm: 16
  19. Đồ án tốt nghiệp Adenovirus, Adeno Associated Virus (AAV), Lentivirus, Retrovirus, Herpes và Baculovirus vector (Singh và ctv, 2009). 17
  20. Đồ án tốt nghiệp CHƯƠNG 3. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1. Thời gian và địa điểm nghiên cứu. Thời gian thực hiện từ ngày 01 tháng 02 năm 2012 đến ngày 21 tháng 07 năm 2012. Địa điểm nghiên cứu: Phòng Sinh Học Thực Nghiệm, Viện Nghiên Cứu Nuôi Trồng Thủy Sản 2, 116 Nguyễn Đình Chiểu, phường Đa Kao, quận 1, thành phố Hồ Chí Minh. 3.2. Vật liệu. 3.2.1. Vật liệu sinh học. Tôm càng xanh trưởng thành khoảng 18–30 g: 2 con đực và 2 con cái, mục đích tách chiết tuyến đực để thu RNA. Địa điểm thu mẫu: Cái Bè (Tiền Giang). Tôm PL25: 60 con sử dụng cho thí nghiệm tiêm sợi dsRNA, thu ở Cái Bè (Tiền Giang). Chủng E.coli JM 109 khả nạp được thương mại hóa (Promega). 3.2.2. Hóa chất thí nghiệm. 3.2.2.1. Primer. Bảng 3.1. Trình tự của các primer trong nghiên cứu. Thứ Sequence primer Primer tự Forward (5’ 3’) Reverse(5’ 3’) TCCCGTCCCTGTCCTATAC CGGTGATTTGACTTTGAGCAT 1 Mr–IAG TTG C Mr–IAG T7PATGGGATACTGGAATG CTGGAACTGCAGGTGTTAAG 3 Sense CCGG Mr–IAG ATGGGATACTGGAATGCC T7PCTGGAACTGCAGGTGTTA 4 Antisense GAG ACG 3.2.2.2. Hóa chất dùng trong ly trích RNA tổng số.  Trizol (phenol pH8, guanidinium thiocyanate, glycerol, sodium acetate). 18
  21. Đồ án tốt nghiệp  Chloroform.  Isopropanol lạnh (bảo quản ở –250C).  Ethanol 70% lạnh (bảo quản ở –250C).  Nước DEPC (nước khử RNase). 3.2.2.3. Hóa chất dùng trong phản ứng RT–PCR, PCR.  Buffer 5X.  dNTP 10mM.  MgCl2 25mM.  Primer F 100pmol/µl.  Primer R 100pmol/µl.  Flexi Taq 5U/µl.  AMV 10U/µl.  Nước. 3.2.2.4. Hóa chất dùng trong điện di agarose.  Agarose (Bio basic).  Dung dịch TBE 0,5X.  Gel red.  6X DNA Loading Dye (Promega). 3.2.2.5. Hóa chất dùng trong tổng hợp Mr–IAG dsRNA.  5X colorless buffer.  dNTP 10 mM.  MgCl2 25 mM.  Flexi Taq 5 U/ μl.  Nuclease free water.  Nước DEPC.  RNase A: phân hủy RNA mạch đơn.  RNase III: phân hủy RNA mạch đôi.  DNase: phân hủy DNA.  Primer Mr–IAG sense (T7P) forward và reverse. 19
  22. Đồ án tốt nghiệp  T7 enzyme mix.  10X T7 Reaction Buffer.  TURBO DNase.  RNA nồng độ 10 ng/ μl.  RiboMAXTM Express T7 2X Buffer.  Enzyme Mix T7 Express. 3.2.3. Dụng cụ – thiết bị thí nghiệm.  Eppendorf 0,2 ml; 0,5 ml; 1,5 ml.  Máy hút và tủ cấy vô trùng (Astec Microflow).  Micropipet các loại (Bio – rad).  Đầu tip các loại.  Bộ dụng cụ vi phẩu.  Máy ly tâm lạnh.  Máy luân nhiệt (Bio – rad).  Máy điện di (Bio – rad).  Máy chụp ảnh điện di DNA – RNA (Bio – rad).  Lò vi sóng (Electrolux – Thụy Điển).  Tủ mát, tủ âm (–250C, –800C) (Sanyo – Nhật). 20
  23. Đồ án tốt nghiệp 3.3. Phương pháp nghiên cứu. Tổng hợp cDNATổng h mợpạ chcDNA khuông mạ ch củ khuôna gene choM.rosenbergii gene Macrobrachium insulin–like androgeneic gland (Mr–IAG)rosenbergi i insulin–like androgen gland (Mr–IAG). Tôm càng xanh đực trưởng thành (18–30) g Trizol Tách chiết RNA tổng số RT–PCR Kiểm tra sản phẩm có kích thước 163 bp RT–PCR cDNA mạch khuôn Dòng hóa và giải trình tự cDNA Dòng hóa sản phẩm PCR Giải trình tự 2 chiều cDNA Tổng hợp Mr–IAG dsRNA bằng phương pháp in vitro. Phương pháp 2 bước Phương pháp 1 bước Thí nghiệm tiêm Mr–IAG dsRNA vào tôm PL25. Nồng độ 5 µg Mr–IAG dsRNA/g Hình 3.1. Sơ đồ nghiên cứu. 21
  24. Đồ án tốt nghiệp 3.3.1. Tổng hợp cDNA mạch khuôn cho gene Macrobrachium rosenbergii insulin–like androgene gland (Mr–IAG). 3.3.1.1. Tách chiết RNA tổng số từ tuyến đực của tôm càng xanh. RNA được tách chiết từ tuyến đực bằng phương pháp tách chiết phenol – chloroform (Trizol – Invitrogene, California, Mĩ). Tôm đực/cái trưởng thành (khoảng 30 g) Phần gốc chân bò số 5 (150–200 mg) 1 ml Trizol, vortex, ủ 5 phút 200 µl Chloroform, vortex, ủ 3 phút Ly tâm 12000/phút trong 15 phút, ở 40C Thu hết dịch nổi 0 Thêm isopropanol lạnh (–20 C) Ủ ít nhất 10 phút ở nhiệt độ phòng Ly tâm 12000 vòng/phút trong 10 phút, ở 40C Loại bỏ dịch nổi, thêm 1 ml ethanol 70%, vortex Ly tâm 7500 vòng/phút trong 5 phút, ở 40C Loại bỏ dịch nổi, làm khô cặn RNA bằng block nhiệt ở 550C Làm tan cặn RNA trong 100 µl nước DEPC Bảo quản –250C Hình 3.2. Sơ đồ tách chiết RNA tổng số từ tuyến đực tôm càng xanh bằng Trizol – phenol. 22
  25. Đồ án tốt nghiệp  Tiến hành. Mẫu: 2 con tôm đực và 2 con tôm cái trưởng thành có trọng lượng khoảng 30 g. Tiến hành vi phẩu lấy tuyến đực – gốc chân bò số 5 hoặc có thể cắt lấy phần mô – khu vực tương đương ở con cái, cho vào 2 eppendorf sạch 1,5 ml, đánh dấu eppendorf chứa mẫu tôm đực và tôm cái. Tiến hành ly trích RNA: dùng micropipette loại 100 – 1000 µl, hút 1000 µl trizol cho vào mỗi eppendorf đã chứa mẫu, tiến hành vortex, ủ ở nhiệt độ phòng trong 5 phút. Khi đó, trizol sẽ được hòa trộn trong mẫu giúp phá vỡ màng tế bào. Sau đó, tiếp tục thêm vào 200 µl chloroform giúp tạo micel phân tán và tiếp xúc đều với dung dịch chất tẩy rửa tăng hiệu quả biến tính protein, đem vortex mạnh trong 20 giây để tách rời các thành phần, rồi đem ủ ở nhiệt độ phòng trong 3 phút. Đem các eppendorf này đi ly tâm với tốc độ 12000 vòng/phút trong 15 phút, ở 40C. Sau ly tâm, hỗn hợp sẽ tách thành 3 pha: lớp dưới cùng có màu đỏ gồm phenol– chloroform, lớp giữa là lớp hữu cơ và lớp dung dịch không màu chứa RNA ở trên cùng. Ly tâm xong tiến hành thu hết dịch nổi (khoảng 500 µl) cho vào eppendorf 1,5 ml khác. Tiếp tục cho 500µl isopropanol lạnh vào các eppendorf chứa dịch nổi vừa thu được, đảo nhẹ 6 – 7 lần. Sau đó, đem các eppendorf này đi ủ ở nhiệt độ phòng ít nhất 10 phút. Tiến hành ly tâm 12000 vòng/phút trong 10 phút, ở 40C. Sau khi ly tâm, tiến hành loại bỏ dịch nổi và hòa tan cặn lóng RNA bằng 1 ml ethanol 70% lạnh, rửa loại muối và isopropanol. Đem các eppendorf này đi vortex, sau đó tiếp tục ly tâm 7500 vòng trong 5 phút. Sau ly tâm, cẩn thận loại bỏ dịch nổi và làm khô cặn RNA bằng cách đun trên block nhiệt 550C khoảng 5 – 10 phút. Cuối cùng, thêm 100 µl nước cất 2 lần vào mỗi eppendorf và đem bảo quản ở –250C. 3.3.1.2. Kiểm tra sản phẩm tách chiết RNA tổng số bằng cặp mồi đặc hiệu Mr–IAG khuếch đại cho sản phẩm 163 bp. Sau khi tách chiết RNA tổng số, tiến hành chạy RT–PCR với cặp mồi đặc hiệu cho tuyến đực Mr – IAG khuếch đại đoạn sản phẩm 163 bp. Nếu vật liệu mẫu chứa sản phẩm có kích thước 163 bp thí chứng tỏ rằng mẫu RNA tổng số tách chiết được 23
  26. Đồ án tốt nghiệp có chứa tuyến đực. Mục đích kiểm tra đảm bảo chất lượng mẫu vật liệu trước khi sử dụng để thực hiện các bước tiếp theo.  Chu trình luân nhiệt. 950 950 720 720 0 ’ ’ 55 0 3 2 45 ’’ 45 ’ 30’’ 10 30’ 40 1X 35X 1X ∞ Hình 3.3. Chu trình luân nhiệt của RT–PCR với cặp mồi đặc hiệu Mr–IAG khuếch đại sản phẩm 163 bp.  Tiến hành. Hút 2 µl dịch ly trích RNA vào ống chứa sẵn 48 µl hỗn hợp phản ứng (Bảng 3.2). Bảng 3.2. Thành phần mix cho phản ứng RT–PCR sử dụng cặp mồi đặc hiệu Mr– IAG. Thứ tự Thành phần Nồng độ Thể tích (µl) 1 Buffer 10X 10 µl 2 dNTP 10 mM 1 µl 3 MgCl2 25 mM 4 µl 4 Mr–IAG F 50 pmol/µl 1 µl 5 Mr–IAG R 50 pmol/µl 1 µl 6 Go Taq 5 U/µl 0,25 µl 7 AMV 10 U/µl 0,5 µl 8 Nước DEPC 30,25 µl 9 RNA 2 µl Total 50 µl 24
  27. Đồ án tốt nghiệp 3.3.1.3. RT–PCR tổng hợp cDNA mạch khuôn.  Nguyên tắc của phương pháp tổng hợp cDNA bằng quy trình RT–PCR. Áp dụng quy trình RT–PCR, sử dụng hóa chất trong bộ hóa chất thương mại của hãng Promega. Quy trình RT–PCR gồm 2 bước được thực hiện trong cùng 1 eppendorf 0,2 ml bằng máy luân nhiệt iCycle (BioRad). Bước 1 Reverse Transcriptase (RT): RNA được phiên mã ngược thành cDNA nhờ enzyme phiên mã ngược AMV Reverse. Enzyme hoạt động ở 45oC trong 30 phút với mồi reverse Mr–IAG sense (T7P). Tất cả các trình tự RNA của Mr–IAG trong mẫu sẽ được phiên mã ngược thành cDNA. Bước 2 PCR: Nguyên tắc giống phản ứng PCR thông thường, cDNA được khuếch đại thành hàng triệu bản sao nhờ Flexi Taq DNA polymerase. Cặp mồi phát hiện đặc hiệu trình tự nucleotide của Mr–IAG là Mr–IAG sense forward and reverse. Kết thúc phản ứng RT–PCR sản phẩm thu được là đoạn trình tự nucleic acid của Mr–IAG dài khoảng 550 bp.  Chu kỳ luân nhiệt. 950 950 720 720 0 ’ ’ 57 0 3 2 45 ’ 1 ’ ’’ 10 30 30’ 40 ∞ 1X 35X 1X Hình 3.4. Chu trình luân nhiệt của RT–PCR với cặp mồi Mr–IAG khuếch đại sản phẩm 518 bp.  Tiến hành. Hút 2 µl dịch ly trích RNA vào ống chứa sẵn 48 µl hỗn hợp phản ứng (Bảng 3.3). Đối chứng âm chỉ có hỗn hợp phản ứng. 25
  28. Đồ án tốt nghiệp Bảng 3.3. Thành phần mix cho phản ứng RT–PCR sử dụng cặp mồi Mr–IAG sense. Thứ tự Thành phần Nồng độ Thể tích (µl) 1 Buffer 5X 10 µl 2 dNTP 10 mM 1 µl 3 MgCl2 25 mM 3 µl 4 Mr–IAG sense (T7P) F 50 pmol/µl 0,5 µl 5 Mr–IAG sense R 50 pmol/µl 0,5 µl 6 Flexi Taq 5 U/µl 0,25 µl 7 AMV 10 U/µl 0,5 µl 8 Nước DEPC 32,25 µl 9 RNA 2 µl Total 50 µl 3.3.1.4. Tinh sạch cDNA mạch khuôn. Sau khi có kết quả chạy điện di trên gel agarose 1,5%, phần gel chứa cDNA template sẽ được cắt ra và tinh sạch bằng Wizard® SV Gel and PCR Clean–Up System Kit (Promega, Mĩ).  Tiến hành. Cho phần gel bị cắt vào 1 eppendorf 1,5 ml sạch và được hòa tan hoàn toàn bằng dung dịch Membrane binding solution (cứ 1 mg tương đương 1 µl dung dịch), đun ở 65oC trong 10 phút. Sau đó phần dung dịch được chuyển vào ống SV mini– column và để ở nhiệt độ phòng trong 1 phút. Ly tâm 14.000 vòng/phút trong 1 phút, loại bỏ phần dịch bên dưới ống SV. Cho 700 µl Membrane wash solution vào ống SV để rửa DNA, ly tâm 14.000 vòng/phút trong 1 phút và tiếp tục đổ bỏ phần dịch bên dưới ống. Sau đó, cho thêm 500 µl Membrane wash solution vào ống SV, tiếp tục ly tâm 14.000 vòng/phút trong 5 phút để rữa DNA một lần nữa. Đổ bỏ phần dịch bên dưới ống và ly tâm tiếp 14.000 vòng/phút trong 1 phút để bay hơi hết 26
  29. Đồ án tốt nghiệp Membrane wash solution. Sau đó cẩn thận chuyển ống SV mini–column vào một eppendorf 1,5 ml vô trùng. Cho 50 µl nuclease–free water vào trực tiếp chính giữa màng lọc của cột, để ở nhiệt độ phòng 1 phút, ly tâm 14.000 vòng/ phút trong 1 phút để thu DNA. Bỏ ống SV mimi–column và bảo quản DNA trong eppendorf ở –20oC. 3.3.2. Dòng hóa và giải trình tự cDNA.  Nguyên tắc. Một lượng cDNA sau khi tinh sạch sẽ được nối với vector pGEM–T Easy và chuyển vào E.coli JM109. Giải trình tự 2 chiều của đoạn cDNA được dòng hóa sau khi vector được tinh sạch và kiểm tra kết quả trên Genebank. 3.3.2.1. Chuyển sản phẩm PCR vào plasmid pGEM–T Easy. Tạo vector tái tổ hợp (pGEM–T chứa sản phẩm PCR). Thành phần phản ứng nối được mô tả theo bảng sau. Bảng 3.4. Thành phần mix của phản ứng nối sản phẩm PCR vào plasmid pGEM–T Easy. Số thứ tự Thành phần Thể tích 1 cDNA tinh sạch 4 µl 2 pGEMT Easy 2 µl 3 T4 ligase Buffer 10X 1 µl 4 T4 DNA ligase 0,5 µl 5 Nước 2,5 µl Total 10 µl 3.3.2.2. Chuyển vector pGEM–T Easy mang sản phẩm PCR vào tế bào vi khuẩn khả nạp E.coli JM 109. Sử dụng phương pháp hóa biến nạp.  Nguyên tắc. Dựa sự lõng lẻo của màng tế bào khả nạp JM 109 khi bị xử lý với dung dịch CaCl2 cùng sự thay đổi nhiệt độ đột ngột (sốc nhiệt) sẽ tạo điều kiện cho đoạn 27
  30. Đồ án tốt nghiệp vector pGEM–T Easy chứa đoạn trình tự Mr–IAG di chuyển vào trong tế bào chất. Sau khi được phục hồi, vector mang gene được nhân lên cùng sự phân chia của tế bào vi khuẩn.  Tiến hành.  Lấy tế bào khả nạp E.coli JM 109 ra khỏi tủ –800C, ủ đá 10 – 20 phút để rã đông từ từ.  Cho 2 µl vector pGEM–T Easy chứa đoạn trình tự Mr– IAG vào eppendorf 1,5 ml giữ trên đá.  Hút 50 µl vi khuẩn khả nạp E.coli JM 109 cho vào ống eppendorf chứa vector tái tổ hợp, búng nhẹ vào thành ống để hòa tan hỗn hợp.  Giữ hỗn hợp trong đá 20 phút.  Sốc nhiệt ở 42oC trong 45 giây. Lập tức đưa ống trở lại đá và giữ yên 2 phút.  Thêm 950 µl dung dịch Soc medium (bảo quản ở nhiệt độ phòng), trộn đều để tế bào phục hồi.  Ủ ống eppendorf chứa hỗn hợp ở 370C và lắc 280 vòng/ phút trong 90 phút.  Sau đó, trải hỗn hợp trên môi trường LB thạch chứa kháng sinh Ampicilin với nồng độ (100 µg/ml). Trải 2 đĩa với thể tích khác nhau (100 µl và 900 µl). Ủ 37oC qua đêm. 3.3.2.3. Kiểm tra dòng tế bào E.coli JM 109 mang vector tái tổ hợp. Một phản ứng PCR được thiết kế nhằm mục đích kiểm tra dòng tế bào E.coli JM 109 có chứa vector pGEM–T Easy hay không và vector có mang đúng trình tự Mr– IAG hay không.  Chu trình luân nhiệt. 28
  31. Đồ án tốt nghiệp 940 940 720 720 570 3’ 30’’ ’ 1 ’ ’’ 10 30 0 4 ∞ 1X 35X 1X Hình 3.5. Chu trình luân nhiệt của phản ứng PCR với cặp mồi T7 promoter khuếch đại sản phẩm 518 bp.  Tiến hành. Chọn các khuẩn lạc rời mọc to tròn để chạy phản ứng PCR kiểm tra kết quả vector (đánh số cho từng khuẩn lạc rời). Phản ứng PCR gồm chứng âm, chứng dương (cDNA mạch khuôn được tổng hợp ở phần 3.3.1.3) và mẫu vi khuẩn chứa vector tái tổ hợp. Dùng đầu tip sạch vô trùng chấm một phần khuẩn lạc cho vào eppendorf chứa sẵn hỗn hợp phản ứng, đánh số theo đúng thứ tự khuẩn lạc cho vào. Bảng 3.5. Thành phần mix cho phản ứng PCR kiểm tra khuẩn lạc mang vector tái tổ hợp sử dụng cặp mồi sense. Thứ tự Thành phần Nồng độ Thể tích (µl) 1 Colorless buffer 5X 10 µl 2 dNTP 10 mM 1 µl 3 MgCl2 25 mM 3 µl 4 Mr–IAG sense (T7P) F 100 pmol/µl 0,5 µl 5 Mr–IAG sense R 100 pmol/µl 0,5 µl 6 Flexi Taq 5 U/µl 0,25 µl 7 Nước DEPC 34,75 µl 8 Khuẩn lạc Total 50 µl 29
  32. Đồ án tốt nghiệp 3.3.2.4. Nhân sinh khối tế bào E.coli JM 109 chứa vector tái tổ hợp mang trình tự nucleotide của Mr–IAG. Sau khi ủ qua đêm, các khuẩn lạc mọc được trên môi trường LB thạch chứa Ampicilin (100 µg/ml) sẽ được kiểm tra bằng PCR. Chọn các khuẩn lạc mang pGEM–T mang Mr–IAG cho kết quả dương tính với vạch tín hiệu khoảng 550 bp đem tăng sinh. Dùng que cấy lấy sinh khối của khuẩn lạc dương tính cấy vào 4 ml môi trường LB lỏng bổ sung 4 µl Ampicilin (100 µg/ml). Nuôi cấy lắc qua đêm ở 370C, 24 giờ. Hút 815 µl dịch vi khuẩn đã nuôi cấy trộn đều với 185 µl glycerol 80%, giữ chủng ở –80oC, phần còn lại ly tâm (4.000 vòng/ phút trong 20 phút ở 4oC) thu sinh khối tách vector pGEM–T mang Mr–IAG. 3.3.2.5. Tinh sạch vector tái tổ hợp. Vector pGEM–T mang Mr–IAG được tinh sạch theo bộ Kit Wizard®Plus SV Minipreps của Promega.  Nguyên tắc. Nguyên tắc của phương pháp này dựa vào khả năng phá hủy các liên kết peptide của protease trong môi trường kiềm và khả năng kết dính của DNA với màng silica trong môi trường muối có nồng độ thích hợp. Tiến hành. Sinh khối vi khuẩn chứa vector tái tổ hợp được tinh sạch bằng cách:  Cho 250 µl dung dịch huyền phù cell resuspension solution, hòa tan hoàn toàn sinh khối để tách rời các tế bào.  Tiếp tục, cho 250 µl dung dịch cell lysis solution vào, đảo trộn đều 4 lần. Ủ 1–5 phút đến khi dịch tế bào trong suốt, dung dịch này có độ kiềm cao sẽ làm DNA tách mạch.  Thêm 10 µl alkalin protease đảo trộn 4 lần, ủ 5 phút ở nhiệt độ phòng để phá vỡ các liên kết peptide làm vụn các thành phần của tế bào, giải phóng DNA.  Tiếp đó, cho 350 µl neutralization solution, đảo trộn đều 4 lần ngay sau đó. Dung dịch này giúp môi trường trung hòa, DNA tái kết cấu sẽ vón cục lại. 30
  33. Đồ án tốt nghiệp  Ly tâm 14000 vòng/phút trong 10 phút, thu dịch nổi chứa DNA và bỏ phần vụn tế bào vi khuẩn bị kết tủa dưới đáy eppendorf.  Hút dịch chuyển sang màng silica trên ống SV, để 1 phút ở nhiệt độ phòng.  Ly tâm 14000 vòng/phút trong 1 phút, DNA sẽ giữ lại còn các thành phần khác sẽ đi qua màng, đổ bỏ phần dịch phía dưới.  Rửa DNA bằng 700 µl dung dịch rửa màng membrane wash solution vào ống SV. Ly tâm 14000 vòng/phút trong 1 phút, bỏ phần dịch phía dưới. Cho 500 µl membrane wash solution vào ống SV ly tâm 14000 vòng/phút trong 5 phút, đổ bỏ phần dịch bên dưới ly tâm lại với tốc độ 14000 vòng/ phút trong 1 phút (không cho thêm dung dịch nào ở bước này).  Cẩn thận chuyển ống SV mini column vào eppendorf 1,5 ml sạch. Cho 50 µl nuclease–free water trực tiếp vào giữa column, ủ nhiệt độ phòng trong 1 phút. Ly tâm 14000 vòng/phút trong 1 phút để tách rửa DNA ra khỏi màng.  Bỏ ống SV mini column, bảo quản dịch DNA ở – 200C. 3.3.2.6. Giải trình tự 2 chiều cDNA. Sau khi tinh sạch vector pGEM–T Easy mang đoạn trình tự Mr–IAG được giải trình tự tại công ty Khoa Học Nam Khoa (Việt nam) bằng cặp mồi: Mr–IAG sense forward và reverse. Phân tích trình tự bằng phần mềm BLAST và so sánh kết quả trên Genebank. 3.3.3. Tổng hợp Mr–IAG dsRNA bằng phương pháp in vitro. 3.3.3.1. Phương pháp 2 bước. Đây là phương pháp truyền thống để tồng hợp dsRNA bằng cách lai hai mạch đơn RNA lại với nhau (Ongvarrasopone và ctv, 2007; Ventura và ctv, 2009).  Nguyên tắc. Tổng hợp 2 mạch đơn RNA sense và antisense có mang T7 promoter. Sau đó lai 2 mạch này lại với nhau thành dsRNA.  Tiến hành.  Tổng hợp 2 mạch khuôn cDNA bằng 2 cặp mồi sense và antisense. 31
  34. Đồ án tốt nghiệp + Chuẩn bị 2 ống dung dịch PCR để tổng hợp 1 trình tự cDNA template có gắn T7 ở cuối đầu forward và 1 trình tự cDNA template gắn T7 ở cuối đầu reverse. Để khuếch đại đoạn gene mục tiêu có gắn T7 promoter ở cuối mỗi mạch. Bảng 3.6. Thành phần mix cho phản ứng PCR sử dụng cặp mồi sense. Thứ tự Thành phần Nồng độ Thể tích (µl) 1 Colorless buffer 5X 10 µl 2 dNTP 10 mM 1 µl 3 MgCl2 25 mM 3 µl 4 Mr–IAG T7P sense F 100 pmol/µl 0,5 µl 5 Mr–IAG sense R 100 pmol/µl 0,5 µl 6 Flexi Taq 5 U/µl 0,25 µl 7 Nước DEPC 32,75 µl 8 pGEM–T mang Mr– 2 µl IAG Total 50 µl Bảng 3.7. Thành phần mix cho phản ứng PCR sử dụng cặp mồi antisense. Thứ tự Thành phần Nồng độ Thể tích (µl) 1 Colorless buffer 5X 10 µl 2 dNTP 10 mM 1 µl 3 MgCl2 25 mM 3 µl 4 Mr–IAG antisense F 100 pmol/µl 0,5 µl 5 Mr–IAG T7P antisense R 100 pmol/µl 0,5 µl 6 Flexi Taq 5 U/µl 0,25 µl 7 Nước DEPC 32,75 µl 8 pGEM–T mang Mr–IAG 2 µl Total 50 µl 32
  35. Đồ án tốt nghiệp  Chu trình luân nhiệt. Giống phần 3.3.2.3.  Tiến hành. + Sau đó tinh sạch sản phẩm PCR (phần 3.3.1.4.) để có được Mr–IAG sense và antisense dùng làm mạch khuôn. + Tổng hợp 2 mạch đơn RNA từ Mr–IAG sense và antisense cho mỗi phản ứng có thể tích 20 μl như sau: Bảng 3.8. Thành phần mix cho phản ứng tổng hợp mạch đơn sense và antisense theo bộ Kit T7 Megascript (Ambion – Mỹ). Thứ tự Thành phần Thể tích (µl) 1 T7 Reaction Buffer 2 µl 2 Nuclease–free water 4 µl 3 ATP 2 µl 4 CTP 2 µl 5 UTP 2 µl 6 GTP 2 µl 7 T7 Enzyme Mix 2 µl 8 Mr–IAG cDNA 4 µl Total 20 µl Đem ủ ở 37oC qua đêm khoảng 16 giờ. Cho 1 μl TURBO DNase vào mỗi phản ứng để loại bỏ cDNA mạch khuôn. Ủ 37oC trong 15 phút. Thu được các RNA mạch đơn.  Lai 2 mạch đơn sense và antisense có gắn T7 promoter để tổng hợp dsRNA bằng bộ Kit T7 Megascript (Ambion–Mỹ). Hai mạch đơn RNA được tổng hợp từ Mr–IAG cDNA đều có T7 promoter ở đầu 3’ của mạch Mr–IAG sense forward và antisense reverse được lai lại với nhau 33
  36. Đồ án tốt nghiệp bằng cách đun nóng ở 70oC trong 10 phút để tổng hợp Mr–IAG dsRNA có T7 promoter ở 2 đầu, sau đó để ở nhiệt độ phòng trong 10 phút. Xử lý Mr–IAG dsRNA bằng RNase A có nồng độ 10ng/μl để loại bỏ hết những RNA mạch đơn còn sót lại sau phản ứng lai. Lấy 1 lượng nhỏ Mr–IAG dsRNA chạy điện di trên gel agarose 1,5% để xác định nồng độ. Bảo quản ở –20oC. 3.3.3.2. Phương pháp 1 bước. Tổng hợp cDNA mạch khuôn mang T7 promoter ở 2 đầu mạch bằng phản ứng PCR sử dụng cặp mồi đặc hiệu đều có T7 promoter ở đầu 5’ (Ongvarrasopone và ctv, 2007). Nguyên tắc: dsRNA được tổng hợp trực tiếp từ cDNA mạch khuôn mang T7 promoter ở 2 đầu sau phản ứng PCR khuếch đại DNA.  Tổng hợp Megascript T7 Kit.  Tiến hành. Để khuếch đại đoạn mạch khuôn cDNA mang T7 promoter ở 2 đầu, chuẩn bị 2 dung dịch phản ứng PCR cho 1 mẫu tổng hợp và 1 mẫu chứng âm. Bảng 3.9. Thành phần mix cho phản ứng PCR với cặp mồi T7P. Thứ tự Thành phần Nồng độ Thể tích (µl) 1 Colorless buffer 5X 10 µl 2 dNTPs 10 mM 1 µl 3 MgCl2 25 mM 3 µl 4 Mr–IAG T7P sense F 100 pmol/µl 0,5 µl 5 Mr–IAG T7P antisense R 100 pmol/µl 0,5 µl 6 Flexi Taq 5 U/µl 0,25 µl 7 Nước DEPC 32,75 µl 8 pGEM–T mang Mr–IAG 2 µl Total 50 µl Đối với mẫu chứng âm thì không cho pGEM–T mang Mr–IAG vào dung dịch phản ứng. 34
  37. Đồ án tốt nghiệp Chu trình luân nhiệt giống phần 2.3.3.1. Sau khi quá trình khuếch đại kết thúc, sản phẩm PCR sẽ được tinh sạch bằng QIAquick Purification Kit. Sản phẩm tinh sạch được dùng để tổng hợp trực tiếp dsRNA bằng Megascript T7 Kit (Ventura và ctv, 2009). Quy trình tổng hợp đã đề cập trên phần 2.3.3.1 nhưng chỉ khác là sản phẩm sau quá trình ủ 16 giờ sẽ là dsRNA nên không cần thực hiện bước lai.  Tổng hợp T7 Express RiboMax iRNA system Kit (Promega, Mỹ). Vào năm 2007, Ongvarrasopone và cộng sự đã đề cập đến việc tổng hợp dsRNA nồng độ cao bằng cách sử dụng T7 Express RiboMax iRNA system Kit (Promega, Mỹ).  Tiến hành.  Chuẩn bị cDNA mạch khuôn. Khuếch đại đoạn mạch khuôn cDNA mang T7 promoter ở 2 đầu, chuẩn bị 2 dung dịch phản ứng PCR cho 1 mẫu tổng hợp và 1 mẫu chứng âm. Giống phần 3.3.3.2.  Tổng hợp sợi dsRNA từ cDNA mạch khuôn. Bảng 3.10. Thành phần mix cho phản ứng để tổng hợp dsRNA theo bộ Kit T7 Express RiboMax iRNA system (Promega, Mỹ). Thứ tự Thành phần Thể tích (µl) 1 RiboMAXTM Express T7 10 µl 2X Buffer 2 Nuclease–free water 4 μl 3 Enzyme mix T7 2 μl 4 T7 cDNA template 4 μl Total 20 µl Ủ qua đêm trong bể ủ nhiệt 370C. Sau khoảng 24 giờ lấy ra, cho ống eppendorf vào heat block 700C, đun trong 10 phút để lai các mạch ssRNA lại với 35
  38. Đồ án tốt nghiệp nhau. Tiếp đó, cho vào tủ lạnh 40C khoảng 5 phút để làm mát dung dịch. Tiếp tục cho 1 μl Turbo DNase và 1 μl RNase (10 ng/ μl), ủ 370C trong 5 phút. Cuối cùng chuyển ống eppendorf này vào block nhiệt ở 700C trong 10 phút để bất hoạt enzyme. Lấy một lượng nhỏ Mr–IAG dsRNA chạy điện di trên gel agarose 1,5% để xác định nồng độ. Bảo quản dsRNA ở –20oC. 3.3.3.3. So sánh hai phương pháp 1 và 2 bước. Sau khi tiến hành tổng hợp Mr–IAG dsRNA theo 2 phương pháp khác nhau, để xác định được phương pháp nào có hiệu suất tổng hợp cao hơn và lựa chọn nó cho thí nghiệm thực nghiệm, tiến hành so sánh nồng độ Mr–IAG dsRNA tổng hợp được bằng 2 phương pháp, sau đó đem điện di trên cùng bảng gel. 3.3.4. Thí nghiệm tiêm Mr–IAG dsRNA vào tôm càng xanh PL25. Tôm PL25 đực, giai đoạn này tôm chỉ có dấu hiệu của con đực mà chưa biệt hóa hoàn toàn thành con đực (chưa mọc gai sinh dục phụ đực) thì mới được sử dụng cho thí nghiệm. Tôm sẽ được chuyển từ Trung Tâm Quốc Gia Giống Thủy Sản Nước Ngọt Nam Bộ (Cái Bè, Tiền Giang) lên phòng thí nghiệm ướt – web lab của phòng Sinh Học Thực Nghiệm – Viện Nghiên Cứu Nuôi Trồng Thủy Sản 2. Trước khi tiến hành thí nghiệm, toàn bộ tôm sẽ được cắt một chân bơi thứ hai ở bên phải và chân bơi này sẽ được kiểm tra trên kính hiển vi xem có gai sinh dục phụ đực hay không để đảm bảo chất lượng và tính chính xác của thí nghiệm. Thí nghiệm sẽ được tiến hành đồng loạt ở một nồng độ tiêm Mr–IAG dsRNA 5μg dsRNA/g trọng lượng tôm và một lô đối chứng chỉ tiêm nước muối sinh lý 0,9%. Tôm thí nghiệm PL25 được nuôi trong thùng nhựa có diện tích 0,2 m2. Tôm được kiểm tra tỷ lệ sống hằng tuần và tỷ lệ chuyển giới sau một tháng. Thời điểm thu thập số liệu để báo cáo là sau 60 ngày với 25 lần tiêm (3 lần/tuần). Khoảng cách mỗi lần tiêm là 2 ngày. Cách tiêm: tiêm Mr–IAG dsRNA vào xoang ở góc chân bò thứ 5 của tôm (Rosen, Sagi và ctv, 2010). Sử dụng kim tiêm Exmire Microsyringe (Fuji, Japan) có 36
  39. Đồ án tốt nghiệp thể tích tối đa là 10µl. Thể tích Mr–IAG dsRNA tùy thuộc vào nồng độ lô thí nghiệm và trọng lượng của tôm. Đến ngày thứ 60, tất cả tôm được cắt chân bơi thứ 2 ở bên phải đem lên kính hiển vi CH4: OLYPUS (Japan) vật kính 10X để kiểm tra gai sinh dục phụ đực có mọc lại hay không. Sau đó tính toán tỷ lệ sống và tỷ lệ chuyển cái của tôm. Bảng 3.11. Bố trí thí nghiệm tiêm Mr–IAG dsRNA. Lô Thí nghiệm Đối chứng Số lượng (con) 40 20 Tần suất tiêm (lần/tuần) 3 3 Nồng độ Mr–IAG dsRNA 5 Nước muối sinh lý 0,9% (µg/g) Thời gian kiểm tra định kỳ 30 30 (ngày) Thời gian thí nghiệm 60 60 (ngày) Đây là thí nghiệm nhằm mục đích kiểm tra xem Mr-IAG có ảnh hưởng lên sự hình thành gai phụ sinh dục đực hay không (có thể nói đây là thí nghiệm “có” hoặc “không”) nên số lượng tôm ở các lô có thể không bằng nhau. 37
  40. Đồ án tốt nghiệp CHƯƠNG 4. KẾT QUẢ VÀ THẢO LUẬN 4.1. Tổng hợp và kiểm tra trình tự Mr–IAG cDNA mạch khuôn. 4.1.1. Tách chiết RNA tổng số từ tôm càng xanh. Sau khi tiến hành tách chiết RNA tổng từ tôm càng xanh đực và cái trưởng thành thu được kết quả như hình 4.1. Hình 4.1. Kết quả tách chiết RNA tổng số từ tôm càng xanh. Giếng 1: RNA tổng số tách chiết từ tôm càng xanh cái trưởng thành; Giếng 2: RNA tổng số tách chiết từ tôm càng xanh đực trưởng thành; Giếng 3 (–): đối chứng âm không chứa mẫu. Từ kết quả thí nghiệm cho thấy RNA tổng số đều có ở cả 2 giới tôm càng xanh đực và cái, hay nói cách khác chúng có mặt ở mỗi cá thể. 38
  41. Đồ án tốt nghiệp 4.1.2. Kiểm tra sản phẩm tách chiết RNA tổng số bằng cặp mồi Mr–IAG khuếch đại cho sản phẩm 163 bp. Hình 4.2. Kết quả khuếch đại sản phẩm 163 bp bằng cặp mồi Mr–IAG từ mẫu RNA tổng số. Giếng 1 (1): thang; giếng 2 (F): sản phẩm khuếch đại từ RNA tổng số của tôm càng xanh cái; Giếng 3 (M): sản phẩm khuếch đại từ RNA tổng số của tôm càng xanh đực; Giếng 4 (–): đối chứng âm. Từ kết quả điện di cho thấy, sự khác biệt rõ rệt giữa tôm càng xanh đực và cái. Ở giếng M xuất hiện vạch có kích thước khoảng 163 bp, giếng F không có sản phẩm. Điều này chứng tỏ ở tôm càng xanh cái không chứa đoạn 163 bp – đoạn gene đặc hiệu cho tuyến đực và được xem marker quy định tuyến đực. Mẫu tách chiết RNA tổng số sẽ bị loại bỏ và không được sử dụng trong các thí nghiệm sau. Lí do, đoạn 518 bp đoạn gen mã hóa cho hormon tuyến đực, chúng nằm trên tuyến đực do đó nếu mẫu tách chiết RNA tổng không chứa tuyến đực thí sẽ bị loại bỏ. Ngoài ra, kết quả còn cho thấy rằng vật liệu mẫu sau khi tách RNA tổng số từ tôm càng xanh đực trưởng thành là đảm bảo chất lượng, chứa đoạn trình tự gene đặc hiệu cho tuyến đực. Vì vậy, có thể sử dụng mẫu này để tiến hành các thí nghiệm tiếp theo. 39
  42. Đồ án tốt nghiệp 4.1.3. Tổng hợp Mr–IAG cDNA mạch khuôn. Trình tự hoàn chỉnh của Mr–IAG có độ dài 1824 bp (NCBI, GeneBank). Đoạn cDNA cần tổng hợp mã hóa thành 173 acid amin, có độ dài 518 bp từ nucleotide 232 đến 750 (Ventura và ctv, 2009). Những vùng dự đoán không có khả năng dịch mã từ nucleotide 1–233 và 755–1824. Điều này có nghĩa là chỉ có đoạn trình tự nucleotide từ 232–750 có thể mã hóa thành hormon tuyến đực. Kiểm tra bằng quy trình RT–PCR, điện di trên gel agarose 1,5%. Dựa vào kết quả chạy điện di, giếng 1 có xuất hiện 1 vạch, so với thang chuẩn DNA thì vạch này có kích thước xấp xỉ 550 bp (518 bp của vùng mã hóa và 20 bp của T7 promoter). Như vậy, đoạn Mr–IAG cDNA mã hóa cho hormon tuyến đực được tách chiết từ tôm càng xanh đực trưởng thành đã tổng hợp thành công. 500 bp Hình 4.3. Kết quả chạy điện di cDNA được tổng hợp từ RNA tổng số tách chiết từ tôm càng xanh cái và đực. 40
  43. Đồ án tốt nghiệp Chạy 2 µl mẫu, gel agarose 1,5%, 100V, 45 phút. Giếng 1 (1): cDNA được tổng hợp từ RNA tổng số của tôm càng xanh đực. Giếng 2 (–): mẫu chứng âm. Giếng 3 (M): thang DNA 50 bp. 4.1.4. Dòng hóa và giải trình tự Mr–IAG cDNA mạch khuôn. Sau khi tổng hợp cDNA mạch khuôn, tiến hành tinh sạch cDNA dự đoán từ gel ở mẫu 2, tạo vector tái tổ hợp pGEM–T mang Mr–IAG cDNA. Tiếp đó, chuyển vector pGEM–T mang Mr–IAG cDNA vào tế bào khả nạp E.coli JM 109, dòng hóa tế bào E.coli JM 109 đã nhận vector tái tổ hợp. Kiểm tra lại tế bào đã được dòng hóa trên môi trường LB agar có bổ sung ampicillin (100 μg/ml). Kết quả có nhiều khuẩn lạc riêng lẻ mọc trên môi trường, chọn 6 khuẩn lạc trong số các khuẩn lạc này đánh dấu, chạy phản ứng PCR kiểm tra kết quả vector. Quá trình kiểm tra các khuẩn lạc mang vector tái tổ hợp bằng phản ứng PCR được thể hiện trên hình 4.4. Hình 4.4. Kiểm tra 6 khóm khuẩn lạc E.coli JM109 nghi ngờ mang trình tự Mr– IAG cDNA mạch khuôn. Giếng 1: thang DNA 50 bp. Giếng 3–8: khuẩn lạc được chọn trên môi trường LB agar/ampicillin. Giếng 2: mẫu đối chứng âm. Giếng 9: mẫu đối chứng dương. Dựa vào hình 4.4 cho thấy, sản phẩm khuếch đại từ 6 khuẩn lạc (giếng 3–8) có vạch kích thước ngang với vạch đối chứng dương (khoảng 550 bp). Như vậy 41
  44. Đồ án tốt nghiệp chứng tỏ 6 khuẩn lạc được đem kiểm tra có mang trình tự Mr–IAG cDNA mong muốn. Chọn 2 khóm khuẩn lạc 1 và 2 (giếng số 3 và 4) chứa trình tự Mr–IAG cDNA dự đoán nuôi tăng sinh trên môi trường LB lỏng có bổ sung ampicilin để thu mẫu bảo quản và tinh sạch. Sau khi kiểm tra lại vector tái tổ hợp pGEM–T mang Mr–IAG cDNA đã tinh sạch bằng phương pháp PCR với cặp mồi Mr–IAG sense (T7P) forward và reverse, vector tái tổ hợp pGEM–T mang Mr–IAG cDNA được giải trình tự tại Công Ty Khoa Học Nam Khoa (Việt Nam) và phân tích trình tự bằng phần mềm BLAST 2.0 và so sánh với trình tự của M. rosenbergii insulin–like androgeneic gland đã công bố trên Genebank (NCBI). Độ tương đồng đến 99% (hình 4.5). Có 7 nucleotide không trùng khớp. Nguyên nhân: có thể sai khác về mặt di truyền (trình tự gene Mr-IAG được công bố trên Genebank có nguồn gốc từ tôm Macrobrachium rosenbergii của nước ngoài, còn ở Việt Nam do điều kiện khí hậu môi trường khác nên có thể sai khác ở một số nucleotide); hoặc sự sai khác đó là do hóa chất (enzyme Taq hoạt động không tốt). Ngoài ra, cũng có thể do sai sót trong quá trình giải trình tự nhưng nguyên nhân này là rất thấp. Tuy nhiên, chúng không ảnh hưởng đến trình tự acid amin được mã hóa từ cDNA mạch khuôn do trình tự acid amine này đã được so sánh với trình tự acid amin được mã hóa từ Mr–IAG mRNA trên NCBI và nó trùng khớp 100% (hình 4.6). Từ đây có thể sử dụng cDNA dự đoán để làm mạch khuôn cho quá trình tổng hợp Mr–IAG dsRNA. 42
  45. Đồ án tốt nghiệp 43
  46. Đồ án tốt nghiệp Hình 4.5. Phần mềm BLAST so sánh trình tự của Mr–IAG cDNA dự đoán với trình tự của Macrobrachium rosenbergii insulin–like androgeneic gland được công bố trên NCBI. Query là trình tự của Mr–IAG cDNA, Sbjct là trình tự của Macrobrachium rosenbergii androgeneic gland specific insulin–like . Hình 4.6. Phầm mềm BLAST so sánh trình tự amino acid được mã hóa từ Mr–IAG cDNA mạch khuôn dự đoán với amino acid được mã hóa từ Mr–IAG mRNA được công bố trên NCBI. 4.2. Tổng hợp Mr–IAG dsRNA theo phương pháp in vitro. 4.2.1. Phương pháp 2 bước. Mr–IAG dsRNA trong thí nghiệm này sẽ được tạo ra bằng cách lai hai loại mạch đơn RNA khác nhau (Ventura và ctv, 2009) được tổng hợp từ cDNA mạch khuôn theo bộ T7 Megascript Kit (Ambion – Mỹ). 44
  47. Đồ án tốt nghiệp Hình 4.7. Kiểm tra nồng độ hai mạch đơn sense và antisense RNA và khả năng xử lý RNA mạch đơn của enzyme RNase. Giếng 1: thang DNA 50 bp. Giếng 2, 3 và 5, 6: mạch đơn sense và antisense RNA pha loãng 1:20 và 1:40 bằng nuclease free water. Giếng 4, 7: mạch sense và antisense RNA ở độ pha loãng 1:20 được xử lý 1 µl enzyme RNase A 10 ng/µl. Quan sát hình 4.7 ta thấy có nhiều vạch sản phẩm phụ xuất hiện trên gel của cả 2 mạch sense và antisense RNA. Vấn đề này có thể là do vật liệu dùng làm Mr– IAG chưa được tinh sạch hoàn toàn. Vì vậy, có nhiều mạch đơn có kích thước ngắn hơn 550 bp xuất hiện khi dùng bộ Kit T7 Megascript. Kiểm tra nồng độ RNA trên hình 4.7, nồng độ mạch đơn sense nhiều khoảng gấp 3 lần mạch antisense dựa vào độ sáng của vạch mẫu và thang DNA. Điều đó chứng tỏ, khi tổng hợp hai mạch đơn riêng biệt thì hiệu suất tổng hợp mạch sense RNA hiệu quả hơn mạch antisense RNA. Từ đây liều lượng của hai mạch sense và antisense sẽ được tính toán điều chỉnh trước khi lai chúng lại với nhau nhằm tiết kiệm hóa chất và giảm bớt nồng độ sản phẩm phụ. Tuy nhiên, việc xác định nồng độ theo phương pháp này cũng không hoàn toàn chính xác. Hiệu suất kiểm tra khả năng xử lý RNA mạch đơn của enzyme RNase A ở giếng số 4 và 7 cho thấy sản phẩm được tạo ra đúng là RNA mạch đơn. Kết quả tổng hợp dsRNA bằng Kit T7 Megascript (Ambion – Mỹ). 45
  48. Đồ án tốt nghiệp 500 bp 200 bp 50 bp Hình 4.8. Mr–IAG dsRNA sau khi lai sense và antisense RNA và được xử lý enzyme RNase A. Giếng 1: Mr–IAG dsRNA không xử lý RNase A ở độ pha loãng 1:20. Giếng 2: Mr– IAG dsRNA xử lý RNase A ở độ pha loãng 1:20. Giếng 3: thang DNA 50bp. 2µl Mr–IAG dsRNA cho vào mỗi giếng, gel agarose 1,5%, TBE 0.5X. Trên hình 4.8, vạch mẫu Mr–IAG dsRNA ở giếng 1 sáng hơn giếng số 2 có thể do còn nhiều RNA mạch đơn sau phản ứng lai. Mr–IAG dsRNA được xử lý RNase A ở giếng số 2 chỉ xuất hiện một vạch tại vị trí có kích thước khoảng 550bp và mờ. 46
  49. Đồ án tốt nghiệp 4.2.2. Phương pháp 1 bước. Hình 4.9. Nồng độ Mr–IAG dsRNA được tổng hợp theo phương pháp 1 bước bằng 2 Kit khác nhau. Giếng 3, 4: sử dụng T7 RiboMax Express IRNA system Kit. Giếng 1: thang DNA 50bp. Giếng 2: Mr–IAG dsRNA không xử lý RNase ở độ pha loãng 1:50. Giếng 3: Mr–IAG dsRNA không xử lý RNase ở độ pha loãng 1:100. Giếng 4: Mr–IAG dsRNA xử lý RNase. Giếng 5, 6, 7: sử dụng Megascript T7 Kit. Giếng 5, Mr– IAG dsRNA không xử lý RNase ở độ pha loãng 1:50. Giếng 6: IAG dsRNA không xử lý RNase ở độ pha loãng 1:100. Giếng 7: Mr–IAG dsRNA xử lý RNase. Dựa trên nguyên tắc tổng hợp Mr–IAG trực tiếp từ cDNA mạch khuôn có T7 ở cả 2 đầu mạch. Dựa vào hình 4.9, vạch ở giếng 5 sáng hơn vạch ở giếng 2 nên hiệu suất tổng hợp Mr–IAG dsRNA trước khi xử lý RNase A bằng T7 Megascript Kit cao hơn T7 RiboMax iRNA System Kit. Tuy nhiên, sau khi xử lý enzyme RNase A thì nồng độ Mr–IAG dsRNA được tổng hợp từ T7 RiboMax iRNA System Kit (giếng 4) lại cao hơn T7 Megascript Kit (giếng 7) cho nên T7 RiboMax iRNA System Kit sẽ được dùng để tổng hợp Mr–IAG dsRNA theo phương pháp 1 bước. 47
  50. Đồ án tốt nghiệp Hình 4.10. Kiểm tra chất lượng RNA mạch đôi (dsRNA). Giếng 1: chứng âm; Giếng 2: thang DNA; Giếng 3: dsRNA sau khi tổng hợp bằng nên T7 RiboMax iRNA System Kit; Giếng 4: dsRNA được xử lý bằng DNase; Giếng 5: xử lý bằng RNase III; Giếng 6: xử lý bằng RNase A. Sau khi tổng hợp được sợi đôi RNA, tiến hành kiểm tra một lần nữa để đảm bảo rằng sợi đôi RNA được tổng hợp chính xác là mạch đôi. Kết quả hình 4.10, cho thấy khi xử lý DNAse – enzyme phân hủy DNA (giếng 4) hay RNAse A – enzyme phân hủy RNA mạch đơn (giếng 6) đều không làm ảnh hưởng đến dsRNA được tổng hợp. Riêng ở giếng 5 khi xử lý bằng RNAse III – enzyme phân hủy RNA mạch đôi thì kết quả là dsRNA bị phân hủy hoàn toàn. Do đó, giếng 5 không xuất hiện vạch sản phẩm. Tất cả những điều này cho phép kết luận rằng sản phẩm dsRNA tổng hợp hoàn toàn là mạch đôi và đủ điều kiện làm vật liệu cho thí nghiệm tiêm dsRNA vào tôm càng xanh đực PL25. 48
  51. Đồ án tốt nghiệp 4.2.3. So sánh hai phương pháp 1 và 2 bước. Kết quả so sánh nồng độ Mr–IAG dsRNA theo phương pháp 1 bước và 2 bước sau khi chạy điện di. 500 bp Hình 4.11. So sánh hiệu suất tổng hợp Mr–IAG dsRNA theo phương pháp 1 bước và 2 bước. Giếng 1: Mr–IAG dsRNA từ phương pháp 1 bước pha loãng 1:50. Giếng 2: Mr– IAG dsRNA từ phương pháp 2 bước pha loãng 1:50. Giếng 3: thang DNA 50 bp. Mỗi giếng cho vào 2µl mẫu, gel agarose 1,5%, 100V, 45 phút, TBE 0,5X. Dựa vào kết quả hình 4.11, vạch ở giếng 1 sáng và rõ hơn vạch ở giếng 2 chứng tỏ nồng độ Mr–IAG dsRNA được tổng hợp từ phương pháp 1 bước nhiều hơn so với phương pháp 2 bước. Điều này có thể do bước lai của phương pháp 2 bước không hiệu quả. Phương pháp 1 bước có hiệu quả kinh tế cao hơn do tiết kiệm được 1 phản ứng trong mỗi lần tổng hợp Mr–IAG dsRNA và bộ T7 RiboMax Express iRNA System Kit có giá thành thấp hơn nhiều so với T7 Megascript Kit, đồng thời hiệu suất tổng hợp Mr–IAG dsRNA cũng cao hơn so với phương pháp 2 bước. 49
  52. Đồ án tốt nghiệp Bảng 4.1. So sánh hiệu suất tổng hợp Mr–IAG dsRNA bằng 2 bộ Kit. Chỉ tiêu T7 RiboMax Express T7 Megascript Kit IRNA System Kit Số phản ứng 50 40 Nồng độ dsRNA tổng hợp >5 mg/ml 1,5–3 mg/ml theo bộ Kit Nồng độ dsRNA tổng hợp 2,5–3 mg/ml 0,5–1 mg/ml được từ thực tế Vì vậy, phương pháp 1 bước là lựa chọn tốt nhất cho việc tổng hợp Mr–IAG dsRNA. 4.3. Thí nghiệm tiêm Mr–IAG dsRNA vào tôm PL25. Sau 60 ngày thí nghiệm ta có kết quả số tôm sống và số tôm chuyển cái như sau. Bảng 4.2. Kết quả thí nghiệm tiêm Mr–IAG dsRNA. Thí nghiệm Đối chứng Lô 30 ngày 60 ngày 30 ngày 60 ngày Nồng độ Mr– Nước muối Nước muối IAG dsRNA 5 5 0 0 sinh lý 0,9 /0 sinh lý 0,9 /0 (µg/g) Số con sống 35 31 18 18 (con) Số con chuyển 34 29 0 0 cái (con) 50
  53. Đồ án tốt nghiệp Hình 4.12. Tỷ lệ sống của tôm sau 60 ngày tiêm. Sau 30 ngày thí nghiệm, tỷ lệ sống của tôm thí nghiệm đạt 87,5% tức có 35 tôm sống trên 40 tôm thí nghiệm. Sau 60 ngày tỷ lệ sống là 77,5% tức 31 tôm sống trên 40 tôm thí nghiệm. Như vậy, sau 60 ngày thí nghiệm tiêm tổng số tôm chết là 9 con, chiếm 22,5%. Riêng ở lô đối chứng tỷ lệ sống cao hơn đạt 90% hình 4.12. Điều này có thể do quá trình tiêm làm ảnh hưởng đến sức sống của tôm thí nghiệm. Ngoài ra, nguyên nhân chết tôm là do không kiểm soát được các điều kiện môi trường như: vi khuẩn gây bệnh đục thân trên tôm, môi trường nước, kinh nghiệm nuôi còn hạn chế, quá trình lột xác, tôm ăn nhau Tất cả tôm ở các lô thí nghiệm và đối chứng sẽ được cắt chân bơi thứ 2 ở bên phải xem dưới kính hiển vi để kiểm tra gai sinh dục phụ đực. 51
  54. Đồ án tốt nghiệp A B C C D E F Hình 4.13. Tác động của Mr–IAG dsRNA lên sự hình thành và phát triển của gai phụ sinh dục đực ở chân bơi thứ 2 bên phải của tôm càng xanh M. Rosenbergii. A: chân bơi thứ 2 của tôm đực đối chứng giai đoạn PL25; B: chân bơi thứ 2 của tôm đực thí nghiệm trước khi tiêm dsRNA; C: chân bơi thứ 2 của tôm đực đối chứng sau 60 ngày; D: chân bơi thứ 2 của tôm thí nghiệm đã chuyển cái; E: chân bơi thứ hai của tôm thí nghiệm bắt đầu xuất hiện nhú lồi của gai phụ sinh dục đực; D: chân bơi thứ 2 của tôm thí nghiệm đã xuất hiện rõ gai phụ sinh dục đực. Vị trí mũi tên màu xanh là gai phụ sinh dục đực. Từ hình 4.13, cho ta thấy giai đoạn trước thí nghiệm thì chân bơi thứ 2 của cả tôm thí nghiệm và tôm đối chứng có đặc điểm hình thái giống nhau. Nhưng sau thời gian thí nghiệm có sự khác biệt rõ rệt giữa tôm đối chứng và tôm thí nghiệm tiêm Mr–IAG dsRNA: ở thí nghiệm tiêm Mr–IAG dsRNA thì hầu hết các cá thể đều không có gai phụ sinh dục đực, chỉ có một vài cá thể có xuất hiện gai phụ sinh dục 52
  55. Đồ án tốt nghiệp đực hoặc xuất hiện nhú lồi sinh dục đực. Riêng tôm đối chứng tất cả tôm đều có gai phụ sinh dục đực. Hình 4.14. Tỷ lệ chuyển cái của tôm sau 60 ngày tiêm. Sau 30 ngày thí nghiệm, tỷ lệ chuyển cái là 97,1%, tỷ lệ tôm đực chiếm 2,9% (1 con). Tỷ lệ chuyển cái sau 60 ngày tiêm là 93,5% và tỷ lệ tôm đực là 6,5% (1 con đực có gai phụ sinh dục đực phát triển rõ và 1 con có dấu hiệu đực, gai phụ sinh dục đực mới xuất hiện). Ở lô đối chứng tất cả tôm đều là tôm đực. Điều này chứng tỏ Mr–IAG dsRNA có tác động tích cực đến quá trình ức chế sự hình thành gai phụ sinh dục đực. Như vậy, sau 60 ngày thí nghiệm có 2 tôm đực và 1 tôm có dấu hiệu đực. Nguyên nhân có thể do trong quá trình chọn tôm ấu trùng PL25 để tiến hành thí nghiệm thì lẫn vào tôm quá ngày tuổi nên Mr–IAG dsRNA không còn tác dụng ức chế gene Mr–IAG của chúng hay trong quá trình tiêm làm thất thoát lượng Mr–IAG dsRNA hoặc cũng có thể do chưa có kinh nghiệm về kỹ thuật tiêm vì vậy mà tiêm chưa đúng vị trí nên Mr–IAG dsRNA chưa có tác động ức chế hoặc ức chế không hoàn toàn các mRNA mã hóa tạo hormon tuyến đực. Từ những số liệu thu thập được có thể kết luận rằng gene Mr–IAG có ảnh hưởng đến việc mã hóa của androgeneic gland (AG) specific insulin–like peptides (mRNA) để tạo hormon tuyến đực cho tôm đực. 53
  56. Đồ án tốt nghiệp CHƯƠNG 5. KẾT LUẬN VÀ ĐỀ NGHỊ Tổng hợp Mr–IAG dsRNA để tạo ra tôm càng xanh cái giả bằng công nghệ iRNA là mục đích chính của nghiên cứu này. Từ những kết quả thu được thì tổng hợp Mr–IAG dsRNA bằng T7 RiboMax Express iRNA System Kit theo phương pháp 1 bước có hiệu quả nhất về mặt chất lượng cũng như hiệu quả kinh tế. Kết quả nghiên cứu từ thí nghiệm tiêm dsRNA vào tôm PL25, cho thấy ở nồng độ 5 µg Mr– IAG dsRNA/g có tác dụng rõ rệt trong việc tạo ra tôm cái giả. Tuy nhiên, cần kéo dài và mở rộng quy mô nghiên cứu này hơn để xác định chính xác nồng độ và số lần tiêm để tạo tôm cái giả. Trong nghiên cứu này tỷ lệ chết là khá cao 22,5%. Do đó, cần tìm ra những biện pháp khắc phục, khống chế được các yếu tố ngoại cảnh dẫn đến tỷ lệ chết cao ở tôm như: xây dựng hệ thống sục khí, lưu thông nước, định kỳ vệ sinh dụng cụ nuôi kiểm soát vi khuẩn gây bệnh. Nâng cao kỹ thuật nuôi, nắm được chu kỳ phát triển và lột xác của tôm để tránh hiện tượng ăn nhau. Cũng cần nghiên cứu thêm về tần suất tiêm để giảm bớt số lần tiêm trong tuần nhằm nâng cao sức sống cho tôm Kiểm tra lại trình tự Mr–IAG dsRNA sau khi tổng hợp bằng cách giải trình tự để xác định chính xác trình tự tổng hợp được có phải là Mr–IAG dsRNA hay không, nhằm nâng cao chất lượng sản phẩm tổng hợp được và tăng hiệu quả bất hoạt mRNA. Ngoài ra, kỹ thuật tiêm cũng đóng vai trò quan trọng trong quá trình chuyển đổi giới tính ở tôm. Nghiên cứu này mở ra một công nghệ mới có thể dùng sản xuất tôm càng xanh cái giả thay cho phương pháp vi phẫu. Cần nghiên cứu thêm những phương pháp tổng hợp Mr-IAG dsRNA khác như tổng hợp bên trong tế bào vi khuẩn nhằm sản xuất Mr-IAG dsRNA với số lượng lớn, tiết kiệm chi phí mà hiệu quả cao. 54
  57. Đồ án tốt nghiệp TÀI LIỆU THAM KHẢO A. Tài liệu sách – tạp chí. Tài liệu tiếng việt. [1] Nguyễn Văn Hảo, Nguyễn Tuần, Hoàng thị Thủy Tiên, Lâm Quyền, Nguyễn Đức Minh, Nguyễn Nhứt và Huỳnh Thị Hồng Châu (2004). Kết quả bước đầu sản xuất giống tôm càng xanh toàn đực, tuyển tập nghề cá Đồng Bằng Sông Cửu Long. Nhà xuất bản nông nghiệp TP.HCM, trang 159 – 177. [2] Chung Quang Trí (2006). Thử nghiệm dùng hormon đực ở giáp xác thuộc bộ mười chân Decapoda để đực hóa hậu ấu trùng tôm càng xanh Macrobrachium rosenbergii de Man. Trường đại học Khoa học Tự Nhiên TP. HCM. [3] Đỗ Năng Vịnh (2007). Công nghệ can thiệp RNA (IRNA) gây bất hoạt và tiềm năng ứng dụng to lớn. Tạp chí công nghệ sinh học 5(3): 265–275. Tài liệu nước ngoài. [4] Charniaux–Cotton H. and Payen G. (1985). Sex differentiati. In The biology of Crustacea. Edited by Bliss D. E. and Mantel L. H. vol. 9, pp. 147–215. New York: Academic Press. [5] Cortney, L. Ohs, Louis R. D’Abramo, Lora Petrie–Hanson, Anita M. Kelly (2006). Apparent control of sexual differentiation of Freshwater Pawn, Macrobrachium rosenbergii, Through Dietary Administration of Dopamine Hydrochloride, Journal of Applied Aquaculture, 18: 4, 19 – 32. [6] Cronin J. et al. (2005). Altering the tropism of lentiviral vectors through pseudotyping. Curr. Gene Ther. 5, 387–398. [7] Davis M.E., et al (2010). Evidence of IRNA in humans from systemically administered siRNA via targeted nanoparticles. Nature. 2010 Apr 15; 464(7291):1067–70. Epub 2010 Mar 21. [8] Eaton B.A. et al. (2002). Dynactin is necessary for synapse stabilization. Neuron 34, 729–741. 55
  58. Đồ án tốt nghiệp [9] Estrada P., Lugo M., Acosta J.l, Carpio Y., Borroto I., Morera Y., Gonzalez O., Rodriguez T., Ramos L., Huberman A. (2007). Effect of RNA interference on gene functions of aquatic organisms. Biotecnologia Aplicada, Vol. 24, No. 2. [10] Fingerman M. (1997), Role of neurotransmitters in regulating reproductive hormon release and gonadal maturation in decapods crustaceans, Invertebrate Reproduction and Development, 31, pp 47– 74. [11] Galvani A. and Sperling L. (2002). RNA interference by feeding in Paramecium. Trends Genet, 18, 11–12. [12] Gao G.P. et al (1996). Biology of adenovirus vectors with E1 and E4 deletions for liver directed gene therapy. J. Virol. 70, 8934–8943. [13] Guan, Haoji (2006). Double–stranded RNA induced gene silencing of neuropeptide genes in sand shrimp, Metapenaeus ensis and development of crustacean primary cell culture. Trường đại học Hồng Kông. [14] Guo S. and Kemphues K.J. par–1, a gene required for establishing polarity in C. elegans embryos, encodes a putative Ser/Thr kinase that is asymmetrically distributed. Cell. 1995 May 19;81(4):611–20. [15] Heister T. et al. (2002). Herpes simplex virus type 1/adeno–associated virus hybrid vectors mediate site–specific integration at the adeno–associated virus preintegration site, AAVS1, on human chromosome 19. J. Virol. 76, 7163–7173. [16] Hui J.H.L., Tobe S.S. and Chan S.M. (2008). Characterization of the putative farnesoic acid O–methyltransferase (LvFAMeT) cDNA from white shrimp, Litopenaeus vannamei: evidence for its role in molting. Peptides 29: 252– 260. [17] Hutvagner G. and Zamore P.D. (2002). iRNA: nature abhors a double–strand. Curr Opin Genetics and Development 12: 225–232. 56
  59. Đồ án tốt nghiệp [18] Issa Z. et al. (2005). Development of methods for RNA interference in the sheep gastrointestinal parasite, Trichostrongylus colubriformis. Int. J. Parasitol. 35, 935–940. [19] Kafri T. et al. (1997). Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors. Nat. Genet. 17, 314–317. [20] Katakura Y. (1989). Endocrin and genetic control of sex differenciation in the malacostracan Crustacea. Invert. Reprod. Development., 16, 177–182. [21] Kawasaki H. and Taira K. (2004). Induction of DNA methylation and gene silencing by short interfering RNAs in human cells. Nature. 2004 Aug 15. [22] Kim D.H, Behlke M.A, Rose S.D, Chang M.S, Choi S., Rossi J.J. (2005). Synthetic dsRNA Dicer substrates enhance IRNA potency and efficacy. Nat Biotechnol. 2005 Fed; 23(2):222–6. [23] King D. S. (1964). Fine structure of the androgeneic gland of the crab, Pachygrapsus crassipes. General and Comparative Endocrinology, vol. 4, no. 5, pp. 533–544. [24] Li et al. Small dsRNAs induce transcriptional activation in human cells. Proc Natl Acad Sci USA. (2006). Nov 14;103(46):17337–42. Epub 2006 Nov 3. [25] Lieber A. et al. (1999). Integrating adenovirus–adeno–associated virus hybrid vectors devoid of all viral genes. J. Virol. 73, 9314–9324. [26] Lu L. et al. (2006). Suppression of porcine arterivirus replication by baculovirus delivered shRNA targeting nucleoprotein. Biochem. Biophys. Res. Commun. 340, 1178–1183. [27] Martin O., Sorokine, Moniatte M., Bulet P., Hetru C., and Dorsselaer A. (1999). The structure of a glycosylated protein hormon responsible for sex determination in the isopod, Armadillidium vulgare. European journal of Biochemistry, vol. 262, no. 3, pp. 727–736. [28] Nagamine C., Knight W., Maggeneti A. and Paxman, G. (1980). Masculinization of female Macrobrachium rosenbergii (de Man) 57
  60. Đồ án tốt nghiệp (Decapoda, Palaemonidae) by androgeneic gland implantation, General and comparative endrocrinology, 31(4) , 442–457. [29] Naldini L. et al. (1996). Efficient transfer, integration, and sustained long–term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc. Natl. Acad. Sci. U. S. A. 93, 11382–11388. [30] Ohs C.L., D`abramo L.R., Hanson L.P. and Kelly A.M. (2006). Apparent control of sexual differentiation of freshwater prawn, Macrobrachium rosenbergii, through dietary administration of dopamine hydrochloride. Journal of Applied Aquaculture. 18(3) :19–32. [31] Ohs C.L., D`abramo L.R. and Kelly A.M. (2006). Effect of dietary administration of 17α–methyltestosterone on the sex ratio of postlarval freshwater prawn, Macrobrachium rosenbergii, during the nursery stage of culture. Journal of the World Aquaculture Society 37: 34–46. [32] Ongvarrasopone C., Roshorm Y. and Panyim S. (2007). A Simple and Cost Effective Method to Generate dsRNA for IRNA Studies in Invertebrates. Science Asia 33: 35–39. [33] O’Neal W.K. et al. (2000). Toxicity associated with repeated administration of first generation adenovirus vectors does not occur with a helper–dependent vector. Mol. Med. 6, 179–195. [34] Paddison P.J. et al. (2002). Short hairpin RNAs (shRNAs) induce sequence– specific silencing in mammalian cells. Genes Dev. 16, 948–958. [35] Palombo F. et al. (1998). Site–specific integration in mammalian cellsmediated by a new hybrid baculovirus–adeno–associated virus vector. J. Virol. 7, 5025–5034. [36] Peng Y. et al. (2007). shRNA driven by Pol II/T7 dual–promoter system effectively induce cell–specific RNA interference in mammalian cells. Biochem. Biophys. Res. Commun. 360, 496–500. [37] Plasterk (2002). RNA silencing: the geneome’s immune system. Science 17 May 2002: Vol. 296 no. 5571 pp. 1263–1265. 58
  61. Đồ án tốt nghiệp [38] Raden Roro Sri Pudji Sinarni Dewi, Ikhsan Khasani, Sularto and Wahyu Pamungkas (2006). Production of female giant freshwater prawn (Macrobrachium rosenbergii) through hormonal induction. Indonesian Aquaculture Jounal, 1(1), pp 35 – 38. [39] Rubinson D.A. et al. (2003). A lentivirus–based systemto functionally silence genes in primary mammalian cells, stem cells and transgeneic mice by RNA interference. Nat. Genet. 33, 401–406. [40] Sachiko Suzuki (1999). Androgeneic gland hormon is a sex–reversing factor but cannot be a sex–determining factor in the female Crustacean Isopods Armadillidium vulgare. General and comparartive endrocrinology, 115(3), 370–378. [41] Samaniego L.A. et al. (1998). Persistence and expression of the herpes simplex virus geneome in the absence of immediate–early proteins. J. Virol. 72, 3307–3320. [42] Sanders B.(1983). Insulin–like peptides in the lobster Homarus americanus.I. insulin immunoreactivity. General and Comparative Endocrinology. 50: 366–373. [43] Sagi A. and Afalo E.D. (2005). The androgeneic gland and monosex culture of freshwater prawn Macrobrachium Rosenbergii (De Man):a biotechnological perspective. Aquaculture Research.36: 231–237. [44] Sagi Amir, Cohen Dan, Milner Yoram (1989). Effect of androgene gland ablation on morphotypic differentiation and sexual characteristics of male Freshwater Prawn, Macrobrachium rosenbergii, General and comparative endocrinology, 77, 15 – 22. [45] Sagi A., Milstein A., Eran Y., Joseph D., Khaila I., Abdu U., Harpaz S. and Karplis I. (1997a). Culture of the Australian redclaw crayfish (Cherax quadricarinatus) in Israel, II. Second growout season of overwintered populations. Israelli Journal of Aquaculture–Bamidgeh. 59:222–229. 59
  62. Đồ án tốt nghiệp [46] Sagi A., Khalaila I., Barki I., Hulata G. and Karplus I. (1996). Intersex red claw crayfish, Cherax quadricarinatu (Von martens): functional males with pre–viellogeneic ovaries. Biol.Bull 190: 16–23. [47] Sagi Amir, Snir Eviatar and Khalaila Isam (1995). Sexual differentiation in decapods crustaceans: role of the androgeneic gland. Invertenrate Reproduction an Development, 31(1–3), 55 – 61. [48] Sagi A. and Ra`ana Z. (1988). Morphotypic differentiation of males of freshwater prawn Macrobrachium rosengergii: changes in the midgut glands and the reproductive system. Journal of crustacean biology. 8: 43– 47. [49] Spence R. Malecha, Patricia, Nevin A., Phyllis Ha, Loena E. Barck, Yara Lamadrid–Rose, Scott Masuno and Dennis Hedgecock (1992). Sex–ratios and sex–determination in progeney from crosses of surgically sex–reversed freshwater prawns, Macrobrachium rosenbergii. Aquaculture, 105(3–4), pp 201–218. [50] Starkey J.L. et al. (2009). Hepatitis B virus (HBV)–specific short hairpin RNA is capable of reducing the formation of HBV covalently closed circular (CCC). [51] Stilwell J.L. and Samulski R.J. (2004). Role of viral vectors and virion shells in cellular gene expression. Mol. Ther. 9, 337–346. [52] Song E. et al. RNA interference targeting Fas protects mice from fulminant hepatitis. Nat Med. 2003 Mar; 9(3):347–51. [53] Soifer H.S. and Kasahara N. (2004). Retrotransposon–adenovirus hybrid vectors: efficient delivery and stable integration of transgenes via a two– stage mechanism. Curr. Gene Ther. 4, 373–384. [54] Suzuki H. et al. (2008). Suppression of hepatitis C virus replication by baculovirus vector–mediated short–hairpin RNA expression. FEBS Lett. 582, 3085–3089. 60
  63. Đồ án tốt nghiệp [55] Tabara H. Grishok, A., Mello, C. (1998). IRNA in C.elegans: Soaking in the Geneome Sequence. Science 16 October 1998: Vol. 282 no. 5388 pp. 430– 431. [56] The Nobel Prize in Physiology ỏ Medicin (2006). RNA interference, pp 1–10. Aigner A (2007). Nonviral in vivo delivery of therapeutic small interfering RNAs. Curr. Opin. Mol. Ther. 9, pp 345–352. [57] Timmons L. and Fire A. (1998). Specific interference by ingested dsRNA. Nature 395, 854. [58] Tiu S.H. and Chan S.M. (2007). The use of recombinant protein and IRNAnterference approaches to study the reproductive functions of a gonad–stimulating hormon from the shrimp Metapenaeus ensis. T. FEBS J 274: 4385–4395. [59] Ventura T., Manor R., Aflalo E.D., Weil S., Raviv S., Glazer L. and Sagi A. (2009). Temporal silencing of an androgeneic gland–specific insulin–like gene affecting phenotypical geneder differences and spermatogenesis. Department of Life. General Endocrinology 150: 1278–1286. [560] Zamore P.D, Tuschl T., Sharp P.A. and Bartel D.P. (2000). IRNA: Double– stranded RNA directs the ATP–dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell. 101: 25–33. B. Tài liệu từ internet. Tài liệu tiếng việt. [61] Bộ nông nghiệp và phát triển nông thôn, viện nghiên cứu nuôi trồng thủy sản 2. Nghiên cứu các giải pháp điều khiển giới tính tôm càng xanh Macrobrachium rosenbergii (2010). [62] Nguyễn Minh Nam. Các RNA không mã hóa protein: một thế giới rộng lớn và tiềm ẩn (5.2011). Tài liệu nước ngoài. 61
  64. Đồ án tốt nghiệp [63] Addgene. Plasmid pGEM–T vector. –database/2854/ [64] Fire A., Xu S., Montgomery M.K., Kostas S.A., Driver S.E., Mello C.C Potent and specific genetic interference by double–stranded RNA in Caenorhabditis elegans (1998). [65] Heriberto Cerutti, Xinrong Ma, Joseph Msanne, Timothy Repas. RNA– mediated silencing in Algae: Biological roles and tools for analysis of gene function (2012). [66] Krishnan P., Gireesh–Babu P., Rajendran K.V., Chaudhari, A. RNA interference–based therapeutics for shrimp viral deseases (2009). [67] Shihao Li, Fuhua Li, Zheng Sun, Jianhai Xiang. Two spliced variants of insulin–like androgeneic gland hormon gene in the Chinese shrimp, Fenneropenaeus chinensis (2012). [68] Snell T.W., Shearer T.L., Smith H.A. Exposure to dsRNA Elicits RNA Interference in Brachionus manjavacas (Rotifera) (5.2010). –dsrna–elicits–rna– interference–brachionus–manjavacas–rotifera–0 [69] The IRNA web. What is iRNA. [70] [71] –Journals/article–3925.html. 62